ModCRE DB

Transcription factor

A2A2N5 - ZFP64

ZFP64 zinc finger protein

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 221 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08275_2.00 NN 70+% CisBP CGCTCCCGGGCCCCC 98.8% identity Open · Scan
Nearest Neighbor (70% - 40%)7
MotifPredictionSourceDNA bindingSupportLogoActions
M01439_2.00 NN 70-40% CisBP TTACGCCACA 57.1% identity Open · Scan
M06797_2.00 NN 70-40% CisBP TTTTTTTTTGTCGTTTTGTG 52.3% identity Open · Scan
M10391_2.00 NN 70-40% CisBP TACCCCACATTTATTTA 51.7% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 51.0% identity Open · Scan
M08525_2.00 NN 70-40% CisBP CCCCGCA 50.8% identity Open · Scan
M00021_2.00 NN 70-40% CisBP TACCCCACAC 50.0% identity Open · Scan
M01540_2.00 NN 70-40% CisBP CTCCCCC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 221 aa
112-219

Region 112-219 0 PWM

Residues
108 aa
Domains
PF00096 · Zinc finger, C2H2 type PF23611 · C2H2 zinc finger PF23611 · C2H2 zinc finger
3D models
1 active PDB
Templates
2I13
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 112-2191 model
Actions
Predicted = Low TFS_A2A2N5:112:219_2i13_A_1 2i13 112-219 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
133-153PF00096Zinc finger, C2H2 typeoverlaps 112-219
161-185PF23611C2H2 zinc fingeroverlaps 112-219
189-213PF23611C2H2 zinc fingeroverlaps 112-219