ModCRE DB

Transcription factor

A6NFS0 - ZNF275

Zinc finger protein 275

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 329 aa

18 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)12
MotifPredictionSourceDNA bindingSupportLogoActions
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 56.6% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 53.5% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 52.3% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 51.1% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 51.1% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 51.1% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 51.1% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 51.1% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 50.8% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 50.8% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 50.0% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 50.0% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_A6NFS0_A6NFS0_HUMAN:207:256_1llm_D_1 ModCRE Homology model GTCGCGCGCGGT Region 207-256 · 1 3D model Open · Scan
TFS_tr_A6NFS0_A6NFS0_HUMAN:103:316_5wjq_D_1 ModCRE Homology model CCTCCCCCCGAAGCTTCCCGGCCCCCCC Region 103-316 · 1 3D model Open · Scan
TFS_tr_A6NFS0_A6NFS0_HUMAN:170:315_2i13_A_1 ModCRE Homology model ATAGCTTGGCCGGCGGTAGAT Region 170-315 · 1 3D model Open · Scan
TFS_tr_A6NFS0_A6NFS0_HUMAN:206:316_5ei9_E_1 ModCRE Homology model GACCCCCCCCCGGGGCC Region 206-316 · 1 3D model Open · Scan
TFS_tr_A6NFS0_A6NFS0_HUMAN:98:323_5v3j_E_1 ModCRE Homology model GGAAGCCCCCGCGCCCGGGGGTC Region 98-323 · 1 3D model Open · Scan
TFS_tr_A6NFS0_A6NFS0_HUMAN:98:323_5v3m_C_1 ModCRE Homology model TCCGAAGTCCACCCGCCCCCCCCG Region 98-323 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 329 aa
98-323

Region 98-323 6 PWM

Residues
226 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 98-3236 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_A6NFS0_A6NFS0_HUMAN:207:256_1llm_D_1 1llm 207-256 View model · PDB
Predicted = Low TFS_tr_A6NFS0_A6NFS0_HUMAN:103:316_5wjq_D_1 5wjq 103-316 View model · PDB
Predicted = Low TFS_tr_A6NFS0_A6NFS0_HUMAN:170:315_2i13_A_1 2i13 170-315 View model · PDB
Predicted = Low TFS_tr_A6NFS0_A6NFS0_HUMAN:206:316_5ei9_E_1 5ei9 206-316 View model · PDB
Predicted = Low TFS_tr_A6NFS0_A6NFS0_HUMAN:98:323_5v3j_E_1 5v3j 98-323 View model · PDB
Predicted = Low TFS_tr_A6NFS0_A6NFS0_HUMAN:98:323_5v3m_C_1 5v3m 98-323 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 5ei9 98:326 206 316 P:E · DNA:A,B 51.4% / 64.9% 100 View · PDB TFS_tr_A6NFS0_A6NFS0_HUMAN:206:316_5ei9_E_1
1 1llm 98:326 207,207 256,256 P:C,D · DNA:A,B 46.0% / 56.0% 57,58 View · PDB DIMER_tr_A6NFS0_A6NFS0_HUMAN:207:256_1llm_D_1
4 2i13 98:326 170 315 P:A · DNA:C,D 45.9% / 58.9% 94 View · PDB TFS_tr_A6NFS0_A6NFS0_HUMAN:170:315_2i13_A_1
1 5wjq 98:326 103 316 P:D · DNA:A,B 41.7% / 61.0% 76 View · PDB TFS_tr_A6NFS0_A6NFS0_HUMAN:103:316_5wjq_D_1
2 5v3m 98:326 98 323 P:C · DNA:A,B 40.0% / 55.7% 81 View · PDB TFS_tr_A6NFS0_A6NFS0_HUMAN:98:323_5v3m_C_1
3 5v3j 98:326 98 323 P:E · DNA:A,B 40.0% / 55.7% 81 View · PDB TFS_tr_A6NFS0_A6NFS0_HUMAN:98:323_5v3j_E_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
101-123PF00096Zinc finger, C2H2 typeoverlaps 98-323
130-151PF00096Zinc finger, C2H2 typeoverlaps 98-323
181-203PF00096Zinc finger, C2H2 typeoverlaps 98-323
209-231PF00096Zinc finger, C2H2 typeoverlaps 98-323
265-287PF00096Zinc finger, C2H2 typeoverlaps 98-323
295-315PF00096Zinc finger, C2H2 typeoverlaps 98-323