ModCRE DB

Transcription factor

A6NJL1 - ZSCAN5B

Zinc finger and SCAN domain-containing protein 5B

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 495 aa

24 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08390_2.00 NN 70+% CisBP GCTTTGTTGACTCAC 76.0% identity Open · Scan
Nearest Neighbor (70% - 40%)23
MotifPredictionSourceDNA bindingSupportLogoActions
M00960_2.00 NN 70-40% CisBP TGCATCCC 56.6% identity Open · Scan
M04587_2.00 NN 70-40% CisBP GTACCTACCGC 55.5% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 55.4% identity Open · Scan
M07579_2.00 NN 70-40% CisBP CATCTCCAGGA 55.2% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 54.2% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.2% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 53.0% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 53.0% identity Open · Scan
M07605_2.00 NN 70-40% CisBP TATTTTTTTTTATTTTTTTTTTTTTTTTTT 52.9% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 52.3% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 52.2% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 52.2% identity Open · Scan
MA0056.1 NN 70-40% JASPAR TGGGGA 51.8% identity Open · Scan
M00764_2.00 NN 70-40% CisBP GTCTACAC 51.4% identity Open · Scan
M07635_2.00 NN 70-40% CisBP AAGTTTTCTTGTATTATATCT 50.7% identity Open · Scan
M08357_2.00 NN 70-40% CisBP GAGCCTGCTACTGAGCCTGGG 50.3% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.0% identity Open · Scan
M01883_2.00 NN 70-40% CisBP TGCCCCTGA 50.0% identity Open · Scan
M07601_2.00 NN 70-40% CisBP CAGATGCCGGCACCATGCTTC 50.0% identity Open · Scan
M07638_2.00 NN 70-40% CisBP TGCAGCTCCCTGCCC 50.0% identity Open · Scan
M07712_2.00 NN 70-40% CisBP ACATTTTTTTAATCTAAAAAAACATTTACA 50.0% identity Open · Scan
M07757_2.00 NN 70-40% CisBP CCGCGGCC 50.0% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 495 aa
354-462

Region 354-462 0 PWM

Residues
109 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF12874 · Zinc-finger of C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 354-4621 model
Actions
Predicted = Low TFS_A6NJL1:354:462_5egb_A_1 5egb 354-462 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
40-122PF02023SCAN domainNo overlap with loaded model regions
355-377PF00096Zinc finger, C2H2 typeoverlaps 354-462
383-405PF00096Zinc finger, C2H2 typeoverlaps 354-462
411-431PF12874Zinc-finger of C2H2 typeoverlaps 354-462
439-461PF00096Zinc finger, C2H2 typeoverlaps 354-462
467-489PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions