ModCRE DB

Transcription factor

A6NN14 - ZNF729

Zinc finger protein 729

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1252 aa

85 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M00955_2.00 NN 70+% CisBP ACGTCCTCT 77.6% identity Open · Scan
Nearest Neighbor (70% - 40%)84
MotifPredictionSourceDNA bindingSupportLogoActions
M07575_2.00 NN 70-40% CisBP TCTCCAAGGCGGCCAGCA 69.6% identity Open · Scan
M07715_2.00 NN 70-40% CisBP CCGCCGCCGCCGTGG 68.5% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 67.0% identity Open · Scan
M08295_2.00 NN 70-40% CisBP CTGCTGGAATCTCCA 65.2% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 64.7% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 64.7% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 64.7% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 64.7% identity Open · Scan
M07714_2.00 NN 70-40% CisBP AGCCCATTGGGGCCTATGCCC 64.0% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 63.5% identity Open · Scan
M07687_2.00 NN 70-40% CisBP ACAAATAAGGTTCTTGTGCCCCCTGCT 63.4% identity Open · Scan
M08381_2.00 NN 70-40% CisBP ACATTTTGTCCTCCTAGTCCT 63.1% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 62.7% identity Open · Scan
M08934_2.00 NN 70-40% CisBP GCTGTACCTGCTTATTAGGC 62.4% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 62.3% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 62.3% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 62.3% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 62.3% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 62.0% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 61.9% identity Open · Scan
M07761_2.00 NN 70-40% CisBP CTGATTATTCACCCA 61.8% identity Open · Scan
MA1599.1 NN 70-40% JASPAR CGGGCCAAGCCCCTAT 61.8% identity Open · Scan
M07613_2.00 NN 70-40% CisBP TCACTCAGTCATTCA 61.3% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 60.5% identity Open · Scan
M07565_2.00 NN 70-40% CisBP CCTCTGGGGGCTCGTCCA 60.4% identity Open · Scan
M08921_2.00 NN 70-40% CisBP CCTCATTCTTCTTGGACATG 60.4% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 60.3% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 60.3% identity Open · Scan
M07775_2.00 NN 70-40% CisBP GCCGAAACCCGGG 59.8% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 59.7% identity Open · Scan
M07586_2.00 NN 70-40% CisBP GGGACCCGGGTGGGGGCGTCCCCC 59.4% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 59.0% identity Open · Scan
M08355_2.00 NN 70-40% CisBP GCGAACTCCTATTCATCC 59.0% identity Open · Scan
M08944_2.00 NN 70-40% CisBP TACCATGCTGTTTTGATTAC 58.8% identity Open · Scan
M08309_2.00 NN 70-40% CisBP AAAAACCCCCCTGCAGAGCCCAGCCCT 57.9% identity Open · Scan
MA1587.1 NN 70-40% JASPAR CCTCGACCTCCTGA 57.6% identity Open · Scan
M08267_2.00 NN 70-40% CisBP CAGTTTCATTTTCC 57.5% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 57.3% identity Open · Scan
M08329_2.00 NN 70-40% CisBP GCTGCATAGTATTCC 56.8% identity Open · Scan
M07753_2.00 NN 70-40% CisBP TGCATTCCTTGGCTTGTG 56.6% identity Open · Scan
M08887_2.00 NN 70-40% CisBP CCTCCTCCAGGAAGCCTTCCCTGA 56.2% identity Open · Scan
MA1602.1 NN 70-40% JASPAR CGTCTACACGGG 56.2% identity Open · Scan
M08860_2.00 NN 70-40% CisBP TCTTATAAGGGCACTAATCCCATT 55.4% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 55.1% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 55.1% identity Open · Scan
M07649_2.00 NN 70-40% CisBP CCCCCCCCCCCCTCAGGAATGCC 55.1% identity Open · Scan
M08395_2.00 NN 70-40% CisBP GCTGCCTACTCTTCC 54.4% identity Open · Scan
M08334_2.00 NN 70-40% CisBP TTTGTTTTTTTCTGATTGCTTTTTACTTAT 54.0% identity Open · Scan
M04621_2.00 NN 70-40% CisBP AGCAATTCCGCTCA 53.7% identity Open · Scan
M07578_2.00 NN 70-40% CisBP CAACTCTCC 53.5% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 53.4% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 53.4% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 53.0% identity Open · Scan
M07727_2.00 NN 70-40% CisBP CGCCGCCTCCCC 52.9% identity Open · Scan
M08283_2.00 NN 70-40% CisBP GACTTTTATTTT 52.9% identity Open · Scan
M08314_2.00 NN 70-40% CisBP ATTCATCAAGGTCCTCAACAATGG 52.9% identity Open · Scan
MA1596.1 NN 70-40% JASPAR GCCTCAGCCTCCCGAG 52.9% identity Open · Scan
M04465_2.00 NN 70-40% CisBP GTGATTCTTATCTTATCCTT 52.8% identity Open · Scan
M07767_2.00 NN 70-40% CisBP AAAAACCCCAGA 52.8% identity Open · Scan
M00143_2.00 NN 70-40% CisBP CCCCCCCACG 52.7% identity Open · Scan
M01044_2.00 NN 70-40% CisBP TCTCTCTTTC 52.7% identity Open · Scan
M07648_2.00 NN 70-40% CisBP GCTTGCAAAAAAAATTTAACTCCCAGCTC 52.7% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 52.7% identity Open · Scan
M01181_2.00 NN 70-40% CisBP GCGCATCCCC 52.5% identity Open · Scan
M00609_2.00 NN 70-40% CisBP GGAAGCCCTA 52.2% identity Open · Scan
M04613_2.00 NN 70-40% CisBP CTCATGTGCTAATTACAAA 52.0% identity Open · Scan
M07707_2.00 NN 70-40% CisBP TCCCGC 51.9% identity Open · Scan
M08311_2.00 NN 70-40% CisBP CTGGAACAGAAGGGGCGA 51.9% identity Open · Scan
M08399_2.00 NN 70-40% CisBP TACTCTGGGGCCACATGACTC 51.8% identity Open · Scan
M07628_2.00 NN 70-40% CisBP AGTGGTTCTGCTTCT 51.5% identity Open · Scan
M08373_2.00 NN 70-40% CisBP CCCCCTGGCTCTTCCTCT 51.5% identity Open · Scan
M07600_2.00 NN 70-40% CisBP GCATTAGC 51.3% identity Open · Scan
MA0753.1 NN 70-40% JASPAR CCCCCCCCAC 51.2% identity Open · Scan
M00142_2.00 NN 70-40% CisBP GTGCTCCT 50.7% identity Open · Scan
M07566_2.00 NN 70-40% CisBP TCAAACCATCCTTGC 50.7% identity Open · Scan
M08342_2.00 NN 70-40% CisBP GCTCTGCCTCCCTCT 50.7% identity Open · Scan
MA1588.1 NN 70-40% JASPAR GAATTCTTGGTTGAC 50.7% identity Open · Scan
M07684_2.00 NN 70-40% CisBP CCTGTTCTTGACTTT 50.6% identity Open · Scan
M08366_2.00 NN 70-40% CisBP GTTTGCTGCTTACAA 50.6% identity Open · Scan
MA1155.1 NN 70-40% JASPAR TGCACACACTGAAAA 50.4% identity Open · Scan
M07659_2.00 NN 70-40% CisBP GTCTTCCAAGTAGCTGGTGTT 50.3% identity Open · Scan
M07777_2.00 NN 70-40% CisBP GCCAATTTCCGTGGTGTAAAT 50.3% identity Open · Scan
M07678_2.00 NN 70-40% CisBP CCCGCCCCCTCCTCCCCCTTCCCACCC 50.1% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1252 aa
316-595

Region 316-595 0 PWM

Residues
280 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 316-5951 model
Actions
Predicted = Low TFS_A6NN14:316:595_5wjq_D_1 5wjq 316-595 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
12-53PF01352KRAB boxNo overlap with loaded model regions
264-286PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
292-314PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
320-342PF00096Zinc finger, C2H2 typeoverlaps 316-595
352-370PF00096Zinc finger, C2H2 typeoverlaps 316-595
376-398PF00096Zinc finger, C2H2 typeoverlaps 316-595
404-426PF00096Zinc finger, C2H2 typeoverlaps 316-595
432-454PF00096Zinc finger, C2H2 typeoverlaps 316-595
460-482PF00096Zinc finger, C2H2 typeoverlaps 316-595
488-510PF00096Zinc finger, C2H2 typeoverlaps 316-595
516-538PF00096Zinc finger, C2H2 typeoverlaps 316-595
544-566PF00096Zinc finger, C2H2 typeoverlaps 316-595
572-594PF00096Zinc finger, C2H2 typeoverlaps 316-595
600-622PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
628-650PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
656-678PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
684-706PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
712-734PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
740-762PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
768-787PF13912C2H2-type zinc fingerNo overlap with loaded model regions
796-818PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
824-846PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
852-874PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
908-930PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
936-958PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
964-986PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
992-1014PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
1020-1042PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
1048-1070PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
1076-1098PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
1104-1126PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
1132-1154PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
1160-1182PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
1188-1210PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions