Transcription factor

A6XGM5

CCCTC-binding factor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 451 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)4

Motif	Prediction	Source	DNA binding	Support	Actions
M08089_2.00	NN 70+%	CisBP	GGTGCCCCCTGGTG	99.7% identity	Open · Scan
MA1102.1	NN 70+%	JASPAR	CACCAGGGGGCACC	99.7% identity	Open · Scan
M08966_2.00	NN 70+%	CisBP	CCAGCGCCCCCTGGTGGCCA	80.0% identity	Open · Scan
MA0139.1	NN 70+%	JASPAR	TGGCCACCAGGGGGCGCTA	80.0% identity	Open · Scan

Nearest Neighbor (70% - 40%)4

Motif	Prediction	Source	DNA binding	Support	Actions
M08540_2.00	NN 70-40%	CisBP	CCCCT	52.5% identity	Open · Scan
M08194_2.00	NN 70-40%	CisBP	GATGGCGCCAC	52.1% identity	Open · Scan
M00948_2.00	NN 70-40%	CisBP	GCAGCACC	50.5% identity	Open · Scan
M00952_2.00	NN 70-40%	CisBP	GGATGCTC	50.5% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 451 aa

285-443

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 285-4431 model

				Actions
Predicted = Low	TFS_A6XGM5:285:443_5t0u_A_1	5t0u	285-443	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
313-336	PF00096	Zinc finger, C2H2 type	overlaps 285-443
398-421	PF00096	Zinc finger, C2H2 type	overlaps 285-443