ModCRE DB

Transcription factor

A8K1I4

Zinc finger protein 668

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 619 aa

20 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)15
MotifPredictionSourceDNA bindingSupportLogoActions
M00944_2.00 NN 70-40% CisBP TCGCTATAA 56.8% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 56.6% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 55.6% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 55.6% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 55.6% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 55.4% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 54.2% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 54.1% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 52.9% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 51.7% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 51.7% identity Open · Scan
MA1514.1 NN 70-40% JASPAR CACCACGCACCCCTT 51.6% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.9% identity Open · Scan
MA1154.1 NN 70-40% JASPAR CTTTCCCACAACACGAC 50.7% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_A8K1I4_A8K1I4_HUMAN:250:299_1llm_D_1 ModCRE Homology model TCGCCGCGCGGG Region 250-299 · 1 3D model Open · Scan
TFS_tr_A8K1I4_A8K1I4_HUMAN:137:414_5wjq_D_1 ModCRE Homology model CACACTGGCTTCTCAGCCCCCCCCCCCC Region 137-414 · 1 3D model Open · Scan
TFS_tr_A8K1I4_A8K1I4_HUMAN:139:414_5v3j_E_1 ModCRE Homology model CCCGGGTCCCCGGGGGCCCCCAGGCC Region 139-414 · 1 3D model Open · Scan
TFS_tr_A8K1I4_A8K1I4_HUMAN:139:414_5v3m_C_1 ModCRE Homology model CGCCGGGACCCCGCCCCCCCGTCCCC Region 139-414 · 1 3D model Open · Scan
TFS_tr_A8K1I4_A8K1I4_HUMAN:185:330_2i13_A_1 ModCRE Homology model AAAACCTAGTTCTAGAAAAAT Region 185-330 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 619 aa
84-414

Region 84-414 5 PWM

Residues
331 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 84-4146 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_A8K1I4_A8K1I4_HUMAN:250:299_1llm_D_1 1llm 250-299 View model · PDB
Predicted = Low TFS_tr_A8K1I4_A8K1I4_HUMAN:137:414_5wjq_D_1 5wjq 137-414 View model · PDB
Predicted = Low TFS_tr_A8K1I4_A8K1I4_HUMAN:139:414_5v3j_E_1 5v3j 139-414 View model · PDB
Predicted = Low TFS_tr_A8K1I4_A8K1I4_HUMAN:139:414_5v3m_C_1 5v3m 139-414 View model · PDB
Predicted = Low TFS_tr_A8K1I4_A8K1I4_HUMAN:185:330_2i13_A_1 2i13 185-330 View model · PDB
Predicted = Low TFS_tr_A8K1I4_A8K1I4_HUMAN:84:383_7w1m_H_1 7w1m 84-383 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
4 2i13 84:421 185 330 P:A · DNA:C,D 51.4% / 70.5% 94 View · PDB TFS_tr_A8K1I4_A8K1I4_HUMAN:185:330_2i13_A_1
2 5v3m 84:421 139 414 P:C · DNA:A,B 43.1% / 60.5% 99 View · PDB TFS_tr_A8K1I4_A8K1I4_HUMAN:139:414_5v3m_C_1
3 5v3j 84:421 139 414 P:E · DNA:A,B 43.1% / 60.5% 99 View · PDB TFS_tr_A8K1I4_A8K1I4_HUMAN:139:414_5v3j_E_1
1 5wjq 84:421 137 414 P:D · DNA:A,B 42.8% / 61.2% 98 View · PDB TFS_tr_A8K1I4_A8K1I4_HUMAN:137:414_5wjq_D_1
1 1llm 84:421 250,250 299,299 P:C,D · DNA:A,B 42.0% / 62.0% 57,58 View · PDB DIMER_tr_A8K1I4_A8K1I4_HUMAN:250:299_1llm_D_1
5 7w1m 84:421 84 383 P:H · DNA:F,G 31.4% / 49.2% 93 View · PDB TFS_tr_A8K1I4_A8K1I4_HUMAN:84:383_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
84-106PF00096Zinc finger, C2H2 typeoverlaps 84-414
112-134PF00096Zinc finger, C2H2 typeoverlaps 84-414
168-190PF00096Zinc finger, C2H2 typeoverlaps 84-414
196-218PF00096Zinc finger, C2H2 typeoverlaps 84-414
224-246PF00096Zinc finger, C2H2 typeoverlaps 84-414
252-274PF00096Zinc finger, C2H2 typeoverlaps 84-414
280-302PF00096Zinc finger, C2H2 typeoverlaps 84-414
308-330PF00096Zinc finger, C2H2 typeoverlaps 84-414
336-358PF00096Zinc finger, C2H2 typeoverlaps 84-414
364-386PF00096Zinc finger, C2H2 typeoverlaps 84-414
392-414PF00096Zinc finger, C2H2 typeoverlaps 84-414
516-538PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
544-566PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
572-594PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions