Region 470-523 5 PWM
- Residues
- 54 aa
- Domains
- PF00096 · Zinc finger, C2H2 type
- 3D models
- 6 active PDBs · 6 summary rows
- Templates
- 1LLM, 3UK3, 4IS1, 6U9Q
- Sources
- Predicted = Low
Transcription factor
A8K2T5
cDNA FLJ77047, highly similar to Homo sapiens zinc finger protein 217 (ZNF217), mRNA
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1012 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)6
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M00780_2.00 | NN 70-40% | CisBP | GACCCCCCGG | 64.2% identity | Open · Scan | |
| MA1584.1 | NN 70-40% | JASPAR | CGACCCCCCGCTGTGC | 64.2% identity | Open · Scan | |
| M03690_2.00 | NN 70-40% | CisBP | AACCACCTGTTA | 52.0% identity | Open · Scan | |
| M08283_2.00 | NN 70-40% | CisBP | GACTTTTATTTT | 51.9% identity | Open · Scan | |
| M06131_2.00 | NN 70-40% | CisBP | ATGTCAAGCCCAAACAAAACCAAAA | 51.5% identity | Open · Scan | |
| M00944_2.00 | NN 70-40% | CisBP | TCGCTATAA | 50.0% identity | Open · Scan |
ModCRE5
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_tr_A8K2T5_A8K2T5_HUMAN:470:521_6u9q_A_1 | ModCRE | Homology model | TAGATTGTAAGT | Region 470-521 · 1 3D model | Open · Scan | |
| TFS_tr_A8K2T5_A8K2T5_HUMAN:470:523_3uk3_D_1 | ModCRE | Homology model | TAAATCCCGG | Region 470-523 · 1 3D model | Open · Scan | |
| TFS_tr_A8K2T5_A8K2T5_HUMAN:470:523_4is1_D_1 | ModCRE | Homology model | AAAGTCCCGG | Region 470-523 · 1 3D model | Open · Scan | |
| TFS_tr_A8K2T5_A8K2T5_HUMAN:471:522_3uk3_C_1 | ModCRE | Homology model | ACAAGGACTGT | Region 471-522 · 1 3D model | Open · Scan | |
| TFS_tr_A8K2T5_A8K2T5_HUMAN:471:522_4is1_C_1 | ModCRE | Homology model | ACAGGGACTGT | Region 471-522 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
1012 aa
470-523
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
6 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 470-5236 models · 6 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_tr_A8K2T5_A8K2T5_HUMAN:472:522_1llm_D_1 | 1llm | 472-522 | View model · PDB |
| Predicted = Low | TFS_tr_A8K2T5_A8K2T5_HUMAN:470:521_6u9q_A_1 | 6u9q | 470-521 | View model · PDB |
| Predicted = Low | TFS_tr_A8K2T5_A8K2T5_HUMAN:470:523_3uk3_D_1 | 3uk3 | 470-523 | View model · PDB |
| Predicted = Low | TFS_tr_A8K2T5_A8K2T5_HUMAN:470:523_4is1_D_1 | 4is1 | 470-523 | View model · PDB |
| Predicted = Low | TFS_tr_A8K2T5_A8K2T5_HUMAN:471:522_3uk3_C_1 | 3uk3 | 471-522 | View model · PDB |
| Predicted = Low | TFS_tr_A8K2T5_A8K2T5_HUMAN:471:522_4is1_C_1 | 4is1 | 471-522 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 1 | 4is1 | 466:525 | 471 | 522 | P:C · DNA:A,B | 98.1% / 98.1% | 100 | View · PDB TFS_tr_A8K2T5_A8K2T5_HUMAN:471:522_4is1_C_1 |
| 2 | 3uk3 | 466:525 | 471 | 522 | P:C · DNA:A,B | 98.1% / 98.1% | 100 | View · PDB TFS_tr_A8K2T5_A8K2T5_HUMAN:471:522_3uk3_C_1 |
| 3 | 4is1 | 466:525 | 470 | 523 | P:D · DNA:A,B | 98.1% / 98.1% | 100 | View · PDB TFS_tr_A8K2T5_A8K2T5_HUMAN:470:523_4is1_D_1 |
| 4 | 3uk3 | 466:525 | 470 | 523 | P:D · DNA:A,B | 98.1% / 98.1% | 100 | View · PDB TFS_tr_A8K2T5_A8K2T5_HUMAN:470:523_3uk3_D_1 |
| 5 | 6u9q | 466:525 | 470 | 521 | P:A · DNA:B,C | 50.0% / 65.4% | 58 | View · PDB TFS_tr_A8K2T5_A8K2T5_HUMAN:470:521_6u9q_A_1 |
| 1 | 1llm | 466:525 | 472,472 | 522,522 | P:C,D · DNA:A,B | 33.3% / 52.9% | 58,60 | View · PDB DIMER_tr_A8K2T5_A8K2T5_HUMAN:472:522_1llm_D_1 |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 128-150 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 158-178 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 376-397 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 472-493 | PF00096 | Zinc finger, C2H2 type | overlaps 470-523 |