ModCRE DB

Transcription factor

A8K2V5

cDNA FLJ77451, highly similar to Homo sapiens nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 (NFATC3), transcript variant 1, mRNA

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1075 aa

7 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M05693_2.00 NN 70+% CisBP ATTTTCCATT 99.9% identity Open · Scan
MA0625.1 NN 70+% JASPAR ATTTTCCATT 99.9% identity Open · Scan
Nearest Neighbor (70% - 40%)5
MotifPredictionSourceDNA bindingSupportLogoActions
M05703_2.00 NN 70-40% CisBP ATTTTCCGTT 64.7% identity Open · Scan
MA0624.1 NN 70-40% JASPAR ATTTTCCATT 52.4% identity Open · Scan
M02446_2.00 NN 70-40% CisBP ATTTTCCATT 51.8% identity Open · Scan
M03449_2.00 NN 70-40% CisBP AGGGAAAATAATTTTCCATT 51.7% identity Open · Scan
MA0152.1 NN 70-40% JASPAR TTTTCCA 51.3% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1075 aa
415-700

Region 415-700 0 PWM

Residues
286 aa
Domains
PF00554 · Rel homology DNA-binding domain PF16179 · Rel homology dimerisation domain
3D models
1 active PDB
Templates
2O93
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 415-7001 model
Actions
Predicted = Low DIMER_A8K2V5:415:700_2o93_L_1 2o93 415-700 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
433-591PF00554Rel homology DNA-binding domainoverlaps 415-700
602-699PF16179Rel homology dimerisation domainoverlaps 415-700