ModCRE DB

Transcription factor

A8K5C0

cDNA FLJ78383, highly similar to Homo sapiens zinc finger protein 337 (ZNF337), mRNA

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 751 aa

21 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07583_2.00 NN 70+% CisBP GAATTTATCACCACT 99.8% identity Open · Scan
Nearest Neighbor (70% - 40%)20
MotifPredictionSourceDNA bindingSupportLogoActions
M00952_2.00 NN 70-40% CisBP GGATGCTC 63.5% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 61.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 60.0% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 60.0% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 58.8% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 58.8% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 58.8% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 57.6% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 56.4% identity Open · Scan
M07610_2.00 NN 70-40% CisBP CCTTCTTCCTCCCCCCTGCCCACC 53.0% identity Open · Scan
M10303_2.00 NN 70-40% CisBP TACTGGGAATACC 52.9% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 51.0% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 51.0% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 50.8% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.5% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 50.4% identity Open · Scan
M07578_2.00 NN 70-40% CisBP CAACTCTCC 50.4% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.0% identity Open · Scan
M06112_2.00 NN 70-40% CisBP CTACTTTCACCGGGG 50.0% identity Open · Scan
M07666_2.00 NN 70-40% CisBP ATCTAGCCCCTGCCTACC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 751 aa
205-483

Region 205-483 0 PWM

Residues
279 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 205-4831 model
Actions
Predicted = Low TFS_A8K5C0:205:483_5wjq_D_1 5wjq 205-483 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
12-52PF01352KRAB boxNo overlap with loaded model regions
208-230PF00096Zinc finger, C2H2 typeoverlaps 205-483
236-258PF00096Zinc finger, C2H2 typeoverlaps 205-483
264-286PF00096Zinc finger, C2H2 typeoverlaps 205-483
292-314PF00096Zinc finger, C2H2 typeoverlaps 205-483
320-342PF00096Zinc finger, C2H2 typeoverlaps 205-483
348-370PF00096Zinc finger, C2H2 typeoverlaps 205-483
376-398PF00096Zinc finger, C2H2 typeoverlaps 205-483
404-426PF00096Zinc finger, C2H2 typeoverlaps 205-483
432-454PF00096Zinc finger, C2H2 typeoverlaps 205-483
460-482PF00096Zinc finger, C2H2 typeoverlaps 205-483
490-510PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
516-538PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
544-566PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
628-650PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
685-707PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
713-735PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions