ModCRE DB

Transcription factor

A8K5X3

Zinc finger protein 770

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 691 aa

7 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08955_2.00 NN 70+% CisBP GATCCTCCCGCCTCAGCCTCCC 98.4% identity Open · Scan
Nearest Neighbor (70% - 40%)6
MotifPredictionSourceDNA bindingSupportLogoActions
M08919_2.00 NN 70-40% CisBP ACAGTTACA 53.1% identity Open · Scan
MA1544.1 NN 70-40% JASPAR AAAACCGTTATTTG 53.1% identity Open · Scan
M07625_2.00 NN 70-40% CisBP TCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 52.8% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 51.0% identity Open · Scan
M10203_2.00 NN 70-40% CisBP CCCCAAACCACCCC 50.0% identity Open · Scan
MA0073.1 NN 70-40% JASPAR CCCCAAACCACCCCCCCCCA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 691 aa
160-244

Region 160-244 0 PWM

Residues
85 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 160-2441 model
Actions
Predicted = Low TFS_A8K5X3:160:244_5egb_A_1 5egb 160-244 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
27-49PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
55-77PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
160-182PF00096Zinc finger, C2H2 typeoverlaps 160-244
188-210PF00096Zinc finger, C2H2 typeoverlaps 160-244
476-497PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
505-525PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
625-647PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
653-675PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions