ModCRE DB

Transcription factor

A8K8Q0

Zinc fingers and homeoboxes protein 3 (Zinc finger and homeodomain protein 3)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 956 aa

5 Generated PWM 10 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_A8K8Q0_A8K8Q0_HUMAN:504:546_2lkx_A_1 ModCRE Homology model ATAAAAATTATTT Region 504-546 · 1 3D model Open · Scan
TFS_tr_A8K8Q0_A8K8Q0_HUMAN:621:665_3d1n_L_1 ModCRE Homology model CTGAAATTCGTCAC Region 621-665 · 1 3D model Open · Scan
TFS_tr_A8K8Q0_A8K8Q0_HUMAN:622:666_1k61_B_1 ModCRE Homology model TTAAAATTATAATTGG Region 622-666 · 1 3D model Open · Scan
TFS_tr_A8K8Q0_A8K8Q0_HUMAN:626:666_1gt0_C_1 ModCRE Homology model ACAAGTGGAT Region 626-666 · 1 3D model Open · Scan
TFS_tr_A8K8Q0_A8K8Q0_HUMAN:626:666_1hf0_B_1 ModCRE Homology model CCCAAAGGAAAAATCCCGTTGG Region 626-666 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 956 aa
504-546
621-666

Region 504-546 1 PWM

Residues
43 aa
Domains
PF00046 · Homeodomain
3D models
1 active PDB · 1 summary row
Templates
2LKX
Sources
Predicted = Low
Scan this region Show models

Region 621-666 4 PWM

Residues
46 aa
Domains
PF00046 · Homeodomain
3D models
9 active PDBs · 9 summary rows
Templates
1APL, 1GT0, 1HF0, 1K61, 1MNM, 3D1N
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
10 active PDB models 10 summary rows
Region 504-5461 model · 1 summary row
Actions
Predicted = Low TFS_tr_A8K8Q0_A8K8Q0_HUMAN:504:546_2lkx_A_1 2lkx 504-546 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 2lkx 497:556 504 546 P:A · DNA:B,C 39.5% / 58.1% 63 View · PDB TFS_tr_A8K8Q0_A8K8Q0_HUMAN:504:546_2lkx_A_1
Region 621-6669 models · 9 summary rows
Actions
Predicted = Low DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:621:665_3d1n_L_1 3d1n 621-665 View model · PDB
Predicted = Low DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:622:666_1apl_C_1 1apl 622-666 View model · PDB
Predicted = Low DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:622:666_1k61_B_1 1k61 622-666 View model · PDB
Predicted = Low DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:622:666_1mnm_D_1 1mnm 622-666 View model · PDB
Predicted = Low DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:626:666_1hf0_B_1 1hf0 626-666 View model · PDB
Predicted = Low TFS_tr_A8K8Q0_A8K8Q0_HUMAN:621:665_3d1n_L_1 3d1n 621-665 View model · PDB
Predicted = Low TFS_tr_A8K8Q0_A8K8Q0_HUMAN:622:666_1k61_B_1 1k61 622-666 View model · PDB
Predicted = Low TFS_tr_A8K8Q0_A8K8Q0_HUMAN:626:666_1gt0_C_1 1gt0 626-666 View model · PDB
Predicted = Low TFS_tr_A8K8Q0_A8K8Q0_HUMAN:626:666_1hf0_B_1 1hf0 626-666 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 1hf0 497:556 626,626 666,666 P:A,B · DNA:M,N 41.5% / 56.1% 32,32 View · PDB DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:626:666_1hf0_B_1
3 1hf0 497:556 626,626 666,666 P:A,B · DNA:M,N 41.5% / 56.1% 32,32 View · PDB TFS_tr_A8K8Q0_A8K8Q0_HUMAN:626:666_1hf0_B_1
4 1gt0 497:556 626 666 P:C · DNA:A,B 41.5% / 56.1% 29 View · PDB TFS_tr_A8K8Q0_A8K8Q0_HUMAN:626:666_1gt0_C_1
3 1k61 497:556 622,622 666,666 P:B,D · DNA:E,F 39.6% / 58.3% 76,77 View · PDB DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:622:666_1k61_B_1
4 1apl 497:556 622,622 666,666 P:C,D · DNA:A,B 39.6% / 58.3% 76,77 View · PDB DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:622:666_1apl_C_1
5 1mnm 497:556 622,622 666,666 P:C,D · DNA:E,F 39.6% / 58.3% 58,58 View · PDB DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:622:666_1mnm_D_1
5 1k61 497:556 622,622 666,666 P:B,D · DNA:E,F 39.6% / 58.3% 76,77 View · PDB TFS_tr_A8K8Q0_A8K8Q0_HUMAN:622:666_1k61_B_1
1 3d1n 497:556 621,621 665,665 P:K,L · DNA:C,D 35.6% / 55.6% 30,31 View · PDB DIMER_tr_A8K8Q0_A8K8Q0_HUMAN:621:665_3d1n_L_1
2 3d1n 497:556 621,621 665,665 P:K,L · DNA:C,D 35.6% / 55.6% 30,31 View · PDB TFS_tr_A8K8Q0_A8K8Q0_HUMAN:621:665_3d1n_L_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
105-155PF18387Zinc-fingers and homeoboxes C2H2 finger domainNo overlap with loaded model regions
318-359PF00046HomeodomainNo overlap with loaded model regions
502-550PF00046Homeodomainoverlaps 504-546
620-666PF00046Homeodomainoverlaps 621-666
850-890PF11569Homeodomain leucine-zipper encoding, HomezNo overlap with loaded model regions