ModCRE DB

Transcription factor

A8K8Y5

cDNA FLJ78762, highly similar to Homo sapiens zinc finger protein 224, mRNA

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 707 aa

46 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08399_2.00 NN 70+% CisBP TACTCTGGGGCCACATGACTC 99.4% identity Open · Scan
Nearest Neighbor (70% - 40%)45
MotifPredictionSourceDNA bindingSupportLogoActions
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 64.7% identity Open · Scan
M07679_2.00 NN 70-40% CisBP TGCGATCTC 63.2% identity Open · Scan
M07654_2.00 NN 70-40% CisBP TGCCCCCTGGTGGC 62.3% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 61.9% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 61.9% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 61.1% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 61.1% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 61.1% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 61.1% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 61.1% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 60.3% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 60.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 60.0% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 58.8% identity Open · Scan
M04653_2.00 NN 70-40% CisBP GGTACGGTTGTCCATGTTGCAA 58.0% identity Open · Scan
M08901_2.00 NN 70-40% CisBP CCAGTTCACACC 56.4% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 56.3% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 54.9% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 54.6% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 54.5% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 54.4% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 54.1% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 54.1% identity Open · Scan
M08267_2.00 NN 70-40% CisBP CAGTTTCATTTTCC 54.0% identity Open · Scan
M07579_2.00 NN 70-40% CisBP CATCTCCAGGA 53.9% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 53.5% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 53.5% identity Open · Scan
M07578_2.00 NN 70-40% CisBP CAACTCTCC 53.3% identity Open · Scan
M04613_2.00 NN 70-40% CisBP CTCATGTGCTAATTACAAA 53.1% identity Open · Scan
M07610_2.00 NN 70-40% CisBP CCTTCTTCCTCCCCCCTGCCCACC 52.9% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 52.8% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 52.1% identity Open · Scan
M08355_2.00 NN 70-40% CisBP GCGAACTCCTATTCATCC 52.0% identity Open · Scan
M07753_2.00 NN 70-40% CisBP TGCATTCCTTGGCTTGTG 51.8% identity Open · Scan
MA1656.1 NN 70-40% JASPAR CCAAGCCCAACCAG 51.2% identity Open · Scan
M08887_2.00 NN 70-40% CisBP CCTCCTCCAGGAAGCCTTCCCTGA 51.0% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 50.9% identity Open · Scan
M07649_2.00 NN 70-40% CisBP CCCCCCCCCCCCTCAGGAATGCC 50.5% identity Open · Scan
M08329_2.00 NN 70-40% CisBP GCTGCATAGTATTCC 50.5% identity Open · Scan
MA1602.1 NN 70-40% JASPAR CGTCTACACGGG 50.4% identity Open · Scan
M04621_2.00 NN 70-40% CisBP AGCAATTCCGCTCA 50.3% identity Open · Scan
M00786_2.00 NN 70-40% CisBP TATATATAT 50.0% identity Open · Scan
M06108_2.00 NN 70-40% CisBP ACAACAACAAC 50.0% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 50.0% identity Open · Scan
M08540_2.00 NN 70-40% CisBP CCCCT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 707 aa
204-362

Region 204-362 0 PWM

Residues
159 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 204-3621 model
Actions
Predicted = Low TFS_A8K8Y5:204:362_5t0u_A_1 5t0u 204-362 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
8-48PF01352KRAB boxNo overlap with loaded model regions
176-198PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
204-226PF00096Zinc finger, C2H2 typeoverlaps 204-362
232-254PF00096Zinc finger, C2H2 typeoverlaps 204-362
260-282PF00096Zinc finger, C2H2 typeoverlaps 204-362
288-310PF00096Zinc finger, C2H2 typeoverlaps 204-362
316-338PF00096Zinc finger, C2H2 typeoverlaps 204-362
372-394PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
400-422PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
456-478PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
484-506PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
512-534PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
540-562PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
568-590PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
596-618PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
652-674PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
681-702PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions