ModCRE DB

Transcription factor

A8K962

Nucleolar transcription factor 1 (Upstream-binding factor 1)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 764 aa

8 Generated PWM 9 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE8
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_A8K962_A8K962_HUMAN:110:266_2gzk_A_1 ModCRE Homology model GGGGGTTAAAAAAATT Region 110-266 · 1 3D model Open · Scan
TFS_tr_A8K962_A8K962_HUMAN:196:374_6hc3_A_1 ModCRE Homology model GTTTCGAGACCCGCTAAAAAA Region 196-374 · 1 3D model Open · Scan
TFS_tr_A8K962_A8K962_HUMAN:196:374_7lbx_B_1 ModCRE Homology model ATTATAAAAAAAAAAAAAAGCGGCGGTAAAAGCCCTCCTTAAAT Region 196-374 · 1 3D model Open · Scan
TFS_tr_A8K962_A8K962_HUMAN:405:470_1hry_A_1 ModCRE Homology model GCACAAAC Region 405-470 · 1 3D model Open · Scan
TFS_tr_A8K962_A8K962_HUMAN:405:470_1hrz_A_1 ModCRE Homology model GCAAAAAA Region 405-470 · 1 3D model Open · Scan
TFS_tr_A8K962_A8K962_HUMAN:405:486_1j47_A_1 ModCRE Homology model GGGTTCCATTTTGG Region 405-486 · 1 3D model Open · Scan
TFS_tr_A8K962_A8K962_HUMAN:407:469_6cij_N_1 ModCRE Homology model ACTTTTAAAAAAAACTT Region 407-469 · 1 3D model Open · Scan
TFS_tr_A8K962_A8K962_HUMAN:408:470_6edb_B_1 ModCRE Homology model AAAGGACAATT Region 408-470 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 764 aa
110-374
405-486

Region 110-374 3 PWM

Residues
265 aa
Domains
PF00505 · HMG (high mobility group) box PF00505 · HMG (high mobility group) box PF09011 · HMG-box domain
3D models
4 active PDBs · 4 summary rows
Templates
2GZK, 6HC3, 7LBX
Sources
Predicted = Low

Region 405-486 5 PWM

Residues
82 aa
Domains
PF00505 · HMG (high mobility group) box PF14887 · HMG (high mobility group) box 5
3D models
5 active PDBs · 1 summary row
Templates
1HRY, 1HRZ, 1J47, 6CIJ, 6EDB
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
9 active PDB models 5 summary rows
Region 110-3744 models · 4 summary rows
Actions
Predicted = Low TFS_tr_A8K962_A8K962_HUMAN:110:266_2gzk_A_1 2gzk 110-266 View model · PDB
Predicted = Low TFS_tr_A8K962_A8K962_HUMAN:196:374_6hc3_A_1 6hc3 196-374 View model · PDB
Predicted = Low TFS_tr_A8K962_A8K962_HUMAN:196:374_7lbx_A_1 7lbx 196-374 View model · PDB
Predicted = Low TFS_tr_A8K962_A8K962_HUMAN:196:374_7lbx_B_1 7lbx 196-374 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
3 6hc3 110:266 196 374 P:A · DNA:B,C 24.2% / 45.6% 93 View · PDB TFS_tr_A8K962_A8K962_HUMAN:196:374_6hc3_A_1
4 7lbx 110:266 196 374 P:B · DNA:C,D,E,F 24.2% / 45.6% 94 View · PDB TFS_tr_A8K962_A8K962_HUMAN:196:374_7lbx_B_1
5 7lbx 110:266 196 374 P:A · DNA:C,D,E,F 24.2% / 45.6% 94 View · PDB TFS_tr_A8K962_A8K962_HUMAN:196:374_7lbx_A_1
1 2gzk 110:266 110 266 P:A · DNA:B,C 20.4% / 46.5% 98 View · PDB TFS_tr_A8K962_A8K962_HUMAN:110:266_2gzk_A_1
Region 405-4865 models · 1 summary row
Actions
Predicted = Low TFS_tr_A8K962_A8K962_HUMAN:405:470_1hry_A_1 1hry 405-470 View model · PDB
Predicted = Low TFS_tr_A8K962_A8K962_HUMAN:405:470_1hrz_A_1 1hrz 405-470 View model · PDB
Predicted = Low TFS_tr_A8K962_A8K962_HUMAN:405:486_1j47_A_1 1j47 405-486 View model · PDB
Predicted = Low TFS_tr_A8K962_A8K962_HUMAN:407:469_6cij_N_1 6cij 407-469 View model · PDB
Predicted = Low TFS_tr_A8K962_A8K962_HUMAN:408:470_6edb_B_1 6edb 408-470 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 6cij 110:266 407 469 P:N · DNA:G,M 38.1% / 58.7% 45 View · PDB TFS_tr_A8K962_A8K962_HUMAN:407:469_6cij_N_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
112-179PF00505HMG (high mobility group) boxoverlaps 110-374
198-263PF00505HMG (high mobility group) boxoverlaps 110-374
299-357PF09011HMG-box domainoverlaps 110-374
407-468PF00505HMG (high mobility group) boxoverlaps 405-486
479-563PF14887HMG (high mobility group) box 5overlaps 405-486