Region 413-695 0 PWM
- Residues
- 283 aa
- Domains
- PF00554 · Rel homology DNA-binding domain PF16179 · Rel homology dimerisation domain
- 3D models
- 1 active PDB
- Templates
- 1IMH
- Sources
- Structure model
Transcription factor
A8K9C6
cDNA FLJ76687, highly similar to Homo sapiens nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATC1), transcript variant 1, mRNA
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 716 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)3
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M03449_2.00 | NN 70+% | CisBP | AGGGAAAATAATTTTCCATT | 99.5% identity | Open · Scan | |
| MA0624.1 | NN 70+% | JASPAR | ATTTTCCATT | 82.5% identity | Open · Scan | |
| M02446_2.00 | NN 70+% | CisBP | ATTTTCCATT | 75.6% identity | Open · Scan |
Nearest Neighbor (70% - 40%)5
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M05703_2.00 | NN 70-40% | CisBP | ATTTTCCGTT | 65.4% identity | Open · Scan | |
| M05693_2.00 | NN 70-40% | CisBP | ATTTTCCATT | 52.0% identity | Open · Scan | |
| MA0625.1 | NN 70-40% | JASPAR | ATTTTCCATT | 52.0% identity | Open · Scan | |
| MA0152.1 | NN 70-40% | JASPAR | TTTTCCA | 50.9% identity | Open · Scan | |
| MA1525.1 | NN 70-40% | JASPAR | AATGGAAAAT | 50.3% identity | Open · Scan |
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
716 aa
413-695
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 413-6951 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_A8K9C6:413:695_1imh_D_1 | 1imh | 413-695 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 428-588 | PF00554 | Rel homology DNA-binding domain | overlaps 413-695 |
| 598-696 | PF16179 | Rel homology dimerisation domain | overlaps 413-695 |