Transcription factor

A8MT65 - ZNF891

Zinc finger protein 891

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 544 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07762_2.00	Known	CisBP	GCCGCGCACAGGCTTCTAGCC	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 544 aa

264-539

Residues: 276 aa
Domains: PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain PF13465 · Zinc-finger double domain PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 264-5391 model

				Actions
Predicted = Low	TFS_A8MT65:264:539_5wjq_D_1	5wjq	264-539	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
42-82	PF01352	KRAB box	No overlap with loaded model regions
320-336	PF00096	Zinc finger, C2H2 type	overlaps 264-539
363-387	PF13465	Zinc-finger double domain	overlaps 264-539
390-414	PF13465	Zinc-finger double domain	overlaps 264-539
432-454	PF00096	Zinc finger, C2H2 type	overlaps 264-539
460-482	PF00096	Zinc finger, C2H2 type	overlaps 264-539
502-527	PF13465	Zinc-finger double domain	overlaps 264-539