ModCRE DB

Transcription factor

B1APH4 - ZNF487

Zinc finger protein 487 (KRAB domain only protein 1)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 207 aa

14 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07782_2.00 Known CisBP CAAAAAAAAAAAAAATAACAAGCAAACAA Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)8
MotifPredictionSourceDNA bindingSupportLogoActions
M08245_2.00 NN 70-40% CisBP TGGTGCCTTATTCCC 62.5% identity Open · Scan
M05853_2.00 NN 70-40% CisBP CCACCTTTAGCCATATCT 54.8% identity Open · Scan
M07583_2.00 NN 70-40% CisBP GAATTTATCACCACT 53.3% identity Open · Scan
M07763_2.00 NN 70-40% CisBP AGAGGTTTCTT 51.6% identity Open · Scan
M00149_2.00 NN 70-40% CisBP CGTACGCC 50.0% identity Open · Scan
M07725_2.00 NN 70-40% CisBP AAGCACTGTACT 50.0% identity Open · Scan
MA1589.1 NN 70-40% JASPAR TAGGAGTGGAATTGCTGGGTC 50.0% identity Open · Scan
MA1593.1 NN 70-40% JASPAR TAACAGCAGACT 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_B1APH4_ZN487_HUMAN:141:205_2i13_A_1 ModCRE Homology model GCCGGCGGGGTAGTT Region 141-205 · 1 3D model Open · Scan
TFS_sp_B1APH4_ZN487_HUMAN:150:205_5v3j_E_1 ModCRE Homology model CCCCCCCCACCA Region 150-205 · 1 3D model Open · Scan
TFS_sp_B1APH4_ZN487_HUMAN:150:205_5v3m_C_1 ModCRE Homology model GGGCCCCCCAACC Region 150-205 · 1 3D model Open · Scan
TFS_sp_B1APH4_ZN487_HUMAN:150:205_5wjq_D_1 ModCRE Homology model CCCCCCGCCTCCA Region 150-205 · 1 3D model Open · Scan
TFS_sp_B1APH4_ZN487_HUMAN:158:200_2kmk_A_1 ModCRE Homology model GGGTGCGGTGCCG Region 158-200 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 207 aa
141-205

Region 141-205 5 PWM

Residues
65 aa
Domains
No overlapping PFAM annotation recorded
3D models
5 active PDBs · 5 summary rows
Templates
2I13, 2KMK, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 5 summary rows
Region 141-2055 models · 5 summary rows
Actions
Predicted = Low TFS_sp_B1APH4_ZN487_HUMAN:141:205_2i13_A_1 2i13 141-205 View model · PDB
Predicted = Low TFS_sp_B1APH4_ZN487_HUMAN:150:205_5v3j_E_1 5v3j 150-205 View model · PDB
Predicted = Low TFS_sp_B1APH4_ZN487_HUMAN:150:205_5v3m_C_1 5v3m 150-205 View model · PDB
Predicted = Low TFS_sp_B1APH4_ZN487_HUMAN:150:205_5wjq_D_1 5wjq 150-205 View model · PDB
Predicted = Low TFS_sp_B1APH4_ZN487_HUMAN:158:200_2kmk_A_1 2kmk 158-200 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 5wjq 141:205 150 205 P:D · DNA:A,B 35.7% / 51.8% 20 View · PDB TFS_sp_B1APH4_ZN487_HUMAN:150:205_5wjq_D_1
2 5v3m 141:205 150 205 P:C · DNA:A,B 35.7% / 51.8% 20 View · PDB TFS_sp_B1APH4_ZN487_HUMAN:150:205_5v3m_C_1
3 5v3j 141:205 150 205 P:E · DNA:A,B 35.7% / 51.8% 20 View · PDB TFS_sp_B1APH4_ZN487_HUMAN:150:205_5v3j_E_1
5 2kmk 141:205 158 200 P:A · DNA:B,C 34.9% / 53.5% 53 View · PDB TFS_sp_B1APH4_ZN487_HUMAN:158:200_2kmk_A_1
4 2i13 141:205 141 205 P:A · DNA:C,D 29.2% / 52.3% 41 View · PDB TFS_sp_B1APH4_ZN487_HUMAN:141:205_2i13_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.