ModCRE DB

Transcription factor

B2R681

cDNA, FLJ92829, highly similar to Homo sapiens MADS box transcription enhancer factor 2, polypeptide C (myocyte enhancer factor 2C) (MEF2C), mRNA

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 473 aa

15 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)4
MotifPredictionSourceDNA bindingSupportLogoActions
MA0497.1 NN 70+% JASPAR ATGCTAAAAATAGAA 99.7% identity Open · Scan
MA0773.1 NN 70+% JASPAR ACTATAAATAGA 80.7% identity Open · Scan
M05557_2.00 NN 70+% CisBP CCAAATATGG 71.6% identity Open · Scan
MA0660.1 NN 70+% JASPAR GCTATAAATAGC 71.6% identity Open · Scan
Nearest Neighbor (70% - 40%)11
MotifPredictionSourceDNA bindingSupportLogoActions
M02697_2.00 NN 70-40% CisBP CCAAAAATGGAAAT 59.4% identity Open · Scan
M10936_2.00 NN 70-40% CisBP TCCGGTGCTAAAAATAGCACCT 59.3% identity Open · Scan
M06985_2.00 NN 70-40% CisBP CCAAAAAAGGAAAGT 59.0% identity Open · Scan
MA0052.1 NN 70-40% JASPAR CTATTTATAG 58.9% identity Open · Scan
M10909_2.00 NN 70-40% CisBP ATTACCATATATAGTAAT 58.3% identity Open · Scan
M08587_2.00 NN 70-40% CisBP TTACCTATAATTAAATTAGCA 57.5% identity Open · Scan
M08144_2.00 NN 70-40% CisBP CCAAAAAAGGAAA 54.0% identity Open · Scan
M10923_2.00 NN 70-40% CisBP ATTACCAAATTGGGAAAT 52.9% identity Open · Scan
M02694_2.00 NN 70-40% CisBP ATTGCCAAATTGGGTAAG 52.1% identity Open · Scan
M08143_2.00 NN 70-40% CisBP CCAAAAATGGA 51.3% identity Open · Scan
M08425_2.00 NN 70-40% CisBP CCAAAAATGGAAAAA 50.7% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 473 aa
2-72

Region 2-72 0 PWM

Residues
71 aa
Domains
PF00319 · SRF-type transcription factor (DNA-binding and dimerisation domain)
3D models
1 active PDB
Templates
3MU6
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 2-721 model
Actions
Predicted = Low DIMER_B2R681:2:72_3mu6_B_1 3mu6 2-72 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
10-57PF00319SRF-type transcription factor (DNA-binding and dimerisation domain)overlaps 2-72
95-154PF12347Holliday junction regulator protein family C-terminal repeatNo overlap with loaded model regions