ModCRE DB

Transcription factor

B2R7C0

Retinoic acid receptor RXR (Nuclear receptor subfamily 2 group B member)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 463 aa

25 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)7
MotifPredictionSourceDNA bindingSupportLogoActions
MA0856.1 NN 70+% JASPAR GGGGTCAAAGGTCA 99.7% identity Open · Scan
M02400_2.00 NN 70+% CisBP GGGGTCAC 98.5% identity Open · Scan
M03421_2.00 NN 70+% CisBP GGGGTCAAAGGTCA 76.7% identity Open · Scan
MA0065.2 NN 70+% JASPAR GTAGGGCAAAGGTCA 76.7% identity Open · Scan
MA0065.1 NN 70+% JASPAR CCAGGGGTCAAAGGTCATCG 76.4% identity Open · Scan
MA0855.1 NN 70+% JASPAR GGGGTCAAAGGTCA 73.0% identity Open · Scan
M03435_2.00 NN 70+% CisBP GGGGTCAAAGGTCA 71.3% identity Open · Scan
Nearest Neighbor (70% - 40%)18
MotifPredictionSourceDNA bindingSupportLogoActions
M09609_2.00 NN 70-40% CisBP CCAGGAACAG 62.9% identity Open · Scan
M01298_2.00 NN 70-40% CisBP AAAGGTCA 62.5% identity Open · Scan
MA0071.1 NN 70-40% JASPAR ATCAAGGTCA 60.5% identity Open · Scan
M00820_2.00 NN 70-40% CisBP TAGGTCACC 59.1% identity Open · Scan
M05621_2.00 NN 70-40% CisBP TAGGTCATGACCTA 59.1% identity Open · Scan
MA1150.1 NN 70-40% JASPAR AATTAGGTCAC 59.1% identity Open · Scan
MA1151.1 NN 70-40% JASPAR ATAAGTAGGTCA 59.1% identity Open · Scan
M01295_2.00 NN 70-40% CisBP AATTTGTAGC 57.1% identity Open · Scan
M03426_2.00 NN 70-40% CisBP GGGGTCAAAGTCCAAT 56.9% identity Open · Scan
M06417_2.00 NN 70-40% CisBP CAGTCCGAAGGTCACCGC 54.8% identity Open · Scan
M02392_2.00 NN 70-40% CisBP GAGGTCAA 54.1% identity Open · Scan
M02388_2.00 NN 70-40% CisBP GAGGTCA 54.0% identity Open · Scan
MA1531.1 NN 70-40% JASPAR GGGTCAGTAGGTCAG 53.4% identity Open · Scan
M05635_2.00 NN 70-40% CisBP GTGACCTCAATGAGGTCAC 52.6% identity Open · Scan
M08226_2.00 NN 70-40% CisBP CAAGGTCA 52.5% identity Open · Scan
M02405_2.00 NN 70-40% CisBP AGAGGTCAGT 51.1% identity Open · Scan
M06413_2.00 NN 70-40% CisBP AAATAGGTCA 50.0% identity Open · Scan
M09275_2.00 NN 70-40% CisBP GGGTCACTTCAGGTCAG 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 463 aa
132-213

Region 132-213 0 PWM

Residues
82 aa
Domains
PF11825 · Nuclear/hormone receptor activator site AF-1 PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
1BY4
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 132-2131 model
Actions
Predicted = Low DIMER_B2R7C0:132:213_1by4_B_1 1by4 132-213 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
25-134PF11825Nuclear/hormone receptor activator site AF-1overlaps 132-213
138-206PF00105Double treble clef zinc finger, C4 typeoverlaps 132-213
258-442PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions