ModCRE DB

Transcription factor

B2RA05

CCCTC-binding factor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 663 aa

7 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA1102.1 NN 70+% JASPAR CACCAGGGGGCACC 99.5% identity Open · Scan
M08089_2.00 NN 70+% CisBP GGTGCCCCCTGGTG 99.4% identity Open · Scan
Nearest Neighbor (70% - 40%)5
MotifPredictionSourceDNA bindingSupportLogoActions
M08966_2.00 NN 70-40% CisBP CCAGCGCCCCCTGGTGGCCA 69.1% identity Open · Scan
MA0139.1 NN 70-40% JASPAR TGGCCACCAGGGGGCGCTA 69.1% identity Open · Scan
M08540_2.00 NN 70-40% CisBP CCCCT 52.5% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 50.5% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 50.5% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 663 aa
285-453

Region 285-453 0 PWM

Residues
169 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 285-4531 model
Actions
Predicted = Low TFS_B2RA05:285:453_5t0u_A_1 5t0u 285-453 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
313-336PF00096Zinc finger, C2H2 typeoverlaps 285-453
398-421PF00096Zinc finger, C2H2 typeoverlaps 285-453
428-451PF00096Zinc finger, C2H2 typeoverlaps 285-453
546-564PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions