Transcription factor

B2RAI2

Zinc finger protein 148

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 794 aa

10 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
MA1653.1	NN 70+%	JASPAR	CCCCCCTCCCCC	99.8% identity		Open · Scan

Nearest Neighbor (70% - 40%)9

Motif	Prediction	Source	DNA binding	Support	Actions
M00143_2.00	NN 70-40%	CisBP	CCCCCCCACG	52.8% identity	Open · Scan
MA0753.1	NN 70-40%	JASPAR	CCCCCCCCAC	52.8% identity	Open · Scan
M10303_2.00	NN 70-40%	CisBP	TACTGGGAATACC	52.4% identity	Open · Scan
M00955_2.00	NN 70-40%	CisBP	ACGTCCTCT	51.8% identity	Open · Scan
M08329_2.00	NN 70-40%	CisBP	GCTGCATAGTATTCC	51.1% identity	Open · Scan
M07645_2.00	NN 70-40%	CisBP	CTCCTT	51.0% identity	Open · Scan
M07562_2.00	NN 70-40%	CisBP	GAAAAAAAC	50.0% identity	Open · Scan
M08247_2.00	NN 70-40%	CisBP	AAAAATAACAAACGG	50.0% identity	Open · Scan
MA1594.1	NN 70-40%	JASPAR	AGGGGACATCACTACAGATCCCAC	50.0% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 794 aa

169-275

Residues: 107 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 2I13
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 169-2751 model

				Actions
Predicted = Low	TFS_B2RAI2:169:275_2i13_A_1	2i13	169-275	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
171-193	PF00096	Zinc finger, C2H2 type	overlaps 169-275
199-221	PF00096	Zinc finger, C2H2 type	overlaps 169-275
227-249	PF00096	Zinc finger, C2H2 type	overlaps 169-275