Transcription factor

B2RCE4

Zinc finger protein 345

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 488 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M04653_2.00	Known	CisBP	GGTACGGTTGTCCATGTTGCAA	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 488 aa

174-334

Residues: 161 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5T0U
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 174-3341 model

				Actions
Predicted = Low	TFS_B2RCE4:174:334_5t0u_A_1	5t0u	174-334	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
63-84	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
90-112	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
118-140	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
146-168	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
174-196	PF00096	Zinc finger, C2H2 type	overlaps 174-334
202-224	PF00096	Zinc finger, C2H2 type	overlaps 174-334
230-252	PF00096	Zinc finger, C2H2 type	overlaps 174-334
272-297	PF13465	Zinc-finger double domain	overlaps 174-334
314-336	PF00096	Zinc finger, C2H2 type	overlaps 174-334
342-364	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
370-392	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
412-436	PF13465	Zinc-finger double domain	No overlap with loaded model regions
454-476	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions