ModCRE DB

Transcription factor

B2RCP2

Zinc finger and BTB domain-containing protein 17 (Zinc finger protein 151)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 803 aa

25 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)21
MotifPredictionSourceDNA bindingSupportLogoActions
M00944_2.00 NN 70-40% CisBP TCGCTATAA 59.0% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 57.8% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 56.7% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 56.6% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 56.0% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 55.7% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 55.6% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 55.5% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 54.4% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 53.6% identity Open · Scan
M06039_2.00 NN 70-40% CisBP TATCTGAAA 53.1% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 52.4% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 52.4% identity Open · Scan
MA1602.1 NN 70-40% JASPAR CGTCTACACGGG 52.0% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 51.7% identity Open · Scan
M02913_2.00 NN 70-40% CisBP TTCGTGGCATTTTTCTA 51.5% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 51.2% identity Open · Scan
M01883_2.00 NN 70-40% CisBP TGCCCCTGA 51.0% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 50.0% identity Open · Scan
M08256_2.00 NN 70-40% CisBP GTGCCTT 50.0% identity Open · Scan
M08283_2.00 NN 70-40% CisBP GACTTTTATTTT 50.0% identity Open · Scan
ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_B2RCP2_B2RCP2_HUMAN:306:580_5wjq_D_1 ModCRE Homology model GGGGAGAAGGCGGGGGGCGGCTGGGGGG Region 306-580 · 1 3D model Open · Scan
TFS_tr_B2RCP2_B2RCP2_HUMAN:333:609_5v3j_E_1 ModCRE Homology model CGCCCTGGTGGGGGTGAAACGGAACC Region 333-609 · 1 3D model Open · Scan
TFS_tr_B2RCP2_B2RCP2_HUMAN:333:609_5v3m_C_1 ModCRE Homology model GTCGGGCCCCCTGCCAGTGCTGGAAA Region 333-609 · 1 3D model Open · Scan
TFS_tr_B2RCP2_B2RCP2_HUMAN:483:635_2i13_A_1 ModCRE Homology model ACGCAACCTGGGTGGGCGGAT Region 483-635 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 803 aa
306-635

Region 306-635 4 PWM

Residues
330 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13894 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13894 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 306-6356 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_B2RCP2_B2RCP2_HUMAN:528:576_1llm_C_1 1llm 528-576 View model · PDB
Predicted = Low TFS_tr_B2RCP2_B2RCP2_HUMAN:306:580_5wjq_D_1 5wjq 306-580 View model · PDB
Predicted = Low TFS_tr_B2RCP2_B2RCP2_HUMAN:307:604_7w1m_H_1 7w1m 307-604 View model · PDB
Predicted = Low TFS_tr_B2RCP2_B2RCP2_HUMAN:333:609_5v3j_E_1 5v3j 333-609 View model · PDB
Predicted = Low TFS_tr_B2RCP2_B2RCP2_HUMAN:333:609_5v3m_C_1 5v3m 333-609 View model · PDB
Predicted = Low TFS_tr_B2RCP2_B2RCP2_HUMAN:483:635_2i13_A_1 2i13 483-635 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
4 2i13 306:640 483 635 P:A · DNA:C,D 48.4% / 60.1% 99 View · PDB TFS_tr_B2RCP2_B2RCP2_HUMAN:483:635_2i13_A_1
1 1llm 306:640 528,528 576,576 P:C,D · DNA:A,B 42.9% / 67.3% 56,57 View · PDB DIMER_tr_B2RCP2_B2RCP2_HUMAN:528:576_1llm_C_1
1 5wjq 306:640 306 580 P:D · DNA:A,B 41.5% / 59.6% 97 View · PDB TFS_tr_B2RCP2_B2RCP2_HUMAN:306:580_5wjq_D_1
2 5v3m 306:640 333 609 P:C · DNA:A,B 41.2% / 59.2% 100 View · PDB TFS_tr_B2RCP2_B2RCP2_HUMAN:333:609_5v3m_C_1
3 5v3j 306:640 333 609 P:E · DNA:A,B 41.2% / 59.2% 100 View · PDB TFS_tr_B2RCP2_B2RCP2_HUMAN:333:609_5v3j_E_1
5 7w1m 306:640 307 604 P:H · DNA:F,G 32.2% / 45.9% 92 View · PDB TFS_tr_B2RCP2_B2RCP2_HUMAN:307:604_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
14-110PF00651BTB/POZ domainNo overlap with loaded model regions
306-328PF00096Zinc finger, C2H2 typeoverlaps 306-635
390-412PF00096Zinc finger, C2H2 typeoverlaps 306-635
418-440PF13894C2H2-type zinc fingeroverlaps 306-635
446-468PF00096Zinc finger, C2H2 typeoverlaps 306-635
475-496PF00096Zinc finger, C2H2 typeoverlaps 306-635
502-524PF13894C2H2-type zinc fingeroverlaps 306-635
531-552PF00096Zinc finger, C2H2 typeoverlaps 306-635
558-580PF00096Zinc finger, C2H2 typeoverlaps 306-635
586-608PF00096Zinc finger, C2H2 typeoverlaps 306-635
614-637PF00096Zinc finger, C2H2 typeoverlaps 306-635