ModCRE DB

Transcription factor

B2RN90 - ZNF776

Zinc finger protein 776

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 476 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07601_2.00 Known CisBP CAGATGCCGGCACCATGCTTC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 476 aa
191-469

Region 191-469 0 PWM

Residues
279 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 191-4691 model
Actions
Predicted = Low TFS_B2RN90:191:469_5wjq_D_1 5wjq 191-469 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
222-244PF00096Zinc finger, C2H2 typeoverlaps 191-469
250-272PF00096Zinc finger, C2H2 typeoverlaps 191-469
278-300PF00096Zinc finger, C2H2 typeoverlaps 191-469
306-328PF00096Zinc finger, C2H2 typeoverlaps 191-469
334-356PF00096Zinc finger, C2H2 typeoverlaps 191-469
362-384PF00096Zinc finger, C2H2 typeoverlaps 191-469
390-412PF00096Zinc finger, C2H2 typeoverlaps 191-469
418-440PF00096Zinc finger, C2H2 typeoverlaps 191-469
446-468PF00096Zinc finger, C2H2 typeoverlaps 191-469