Region 9-158 1 PWM
- Residues
- 150 aa
- Domains
- PF09011 · HMG-box domain PF00505 · HMG (high mobility group) box
- 3D models
- 5 active PDBs · 5 summary rows
- Templates
- 5ZDZ, 5ZE0, 5ZE1, 5ZE2, 6CIJ
- Sources
- Predicted = Low
Transcription factor
B2RPK0 - HMGB1P1
High mobility group protein B1-like 1 (High mobility group protein 1-like 1) (HMG-1L1)
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 211 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_sp_B2RPK0_HGB1A_HUMAN:9:158_6cij_N_1 | ModCRE | Homology model | TATCCTCGGGCGCCATATAAAATTTCTAAT | Region 9-158 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
211 aa
9-158
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models
5 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 9-1585 models · 5 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_sp_B2RPK0_HGB1A_HUMAN:10:157_5ze0_N_1 | 5ze0 | 10-157 | View model · PDB |
| Predicted = Low | TFS_sp_B2RPK0_HGB1A_HUMAN:11:157_5zdz_N_1 | 5zdz | 11-157 | View model · PDB |
| Predicted = Low | TFS_sp_B2RPK0_HGB1A_HUMAN:11:157_5ze1_N_1 | 5ze1 | 11-157 | View model · PDB |
| Predicted = Low | TFS_sp_B2RPK0_HGB1A_HUMAN:11:157_5ze2_N_1 | 5ze2 | 11-157 | View model · PDB |
| Predicted = Low | TFS_sp_B2RPK0_HGB1A_HUMAN:9:158_6cij_N_1 | 6cij | 9-158 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 1 | 6cij | 8:170 | 9 | 158 | P:N · DNA:G,M | 84.0% / 84.7% | 100 | View · PDB TFS_sp_B2RPK0_HGB1A_HUMAN:9:158_6cij_N_1 |
| 2 | 5ze0 | 8:170 | 10 | 157 | P:N · DNA:G,M | 75.0% / 75.7% | 100 | View · PDB TFS_sp_B2RPK0_HGB1A_HUMAN:10:157_5ze0_N_1 |
| 3 | 5ze2 | 8:170 | 11 | 157 | P:N · DNA:G,M | 74.8% / 75.5% | 100 | View · PDB TFS_sp_B2RPK0_HGB1A_HUMAN:11:157_5ze2_N_1 |
| 4 | 5ze1 | 8:170 | 11 | 157 | P:N · DNA:G,M | 74.8% / 75.5% | 100 | View · PDB TFS_sp_B2RPK0_HGB1A_HUMAN:11:157_5ze1_N_1 |
| 5 | 5zdz | 8:170 | 11 | 157 | P:N · DNA:G,M | 74.8% / 75.5% | 100 | View · PDB TFS_sp_B2RPK0_HGB1A_HUMAN:11:157_5zdz_N_1 |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 6-78 | PF09011 | HMG-box domain | overlaps 9-158 |
| 95-162 | PF00505 | HMG (high mobility group) box | overlaps 9-158 |