ModCRE DB

Transcription factor

B3KMY9

cDNA FLJ12963 fis, clone NT2RP2005722, highly similar to Zinc finger protein 443

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 675 aa

36 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
M07659_2.00 NN 70+% CisBP GTCTTCCAAGTAGCTGGTGTT 98.8% identity Open · Scan
M07733_2.00 NN 70+% CisBP TCTTTCTCTCTCTCC 88.0% identity Open · Scan
M07731_2.00 NN 70+% CisBP TTTCCCAGCAGCAACAGCACCGCCCCCCCC 71.3% identity Open · Scan
Nearest Neighbor (70% - 40%)33
MotifPredictionSourceDNA bindingSupportLogoActions
M00939_2.00 NN 70-40% CisBP CCACCTCA 63.5% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 61.4% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 60.2% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 60.2% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 59.0% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 59.0% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 57.8% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 57.8% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 57.6% identity Open · Scan
M07770_2.00 NN 70-40% CisBP CTTGGACTT 57.5% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 57.4% identity Open · Scan
M07717_2.00 NN 70-40% CisBP GGCTCCGCCCCC 57.4% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 56.4% identity Open · Scan
M08908_2.00 NN 70-40% CisBP GCTGCTGCTTCTGCTG 56.0% identity Open · Scan
M04653_2.00 NN 70-40% CisBP GGTACGGTTGTCCATGTTGCAA 54.4% identity Open · Scan
MA1588.1 NN 70-40% JASPAR GAATTCTTGGTTGAC 54.4% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 54.0% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 53.9% identity Open · Scan
M07628_2.00 NN 70-40% CisBP AGTGGTTCTGCTTCT 53.4% identity Open · Scan
M00609_2.00 NN 70-40% CisBP GGAAGCCCTA 53.2% identity Open · Scan
M08366_2.00 NN 70-40% CisBP GTTTGCTGCTTACAA 53.0% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 52.9% identity Open · Scan
M07635_2.00 NN 70-40% CisBP AAGTTTTCTTGTATTATATCT 52.4% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 51.8% identity Open · Scan
M03671_2.00 NN 70-40% CisBP ATTACCATACAAGTGCAC 51.2% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 51.1% identity Open · Scan
M08901_2.00 NN 70-40% CisBP CCAGTTCACACC 51.0% identity Open · Scan
M05853_2.00 NN 70-40% CisBP CCACCTTTAGCCATATCT 50.6% identity Open · Scan
M04536_2.00 NN 70-40% CisBP ACGTAACCCGATACC 50.5% identity Open · Scan
M08367_2.00 NN 70-40% CisBP GGGGTGATGACCACTCTGGCTTCTTAC 50.1% identity Open · Scan
M01042_2.00 NN 70-40% CisBP TGGGACCTGA 50.0% identity Open · Scan
M01538_2.00 NN 70-40% CisBP GCCCCTGA 50.0% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 675 aa
196-306

Region 196-306 0 PWM

Residues
111 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
6E93
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 196-3061 model
Actions
Predicted = Low TFS_B3KMY9:196:306_6e93_A_1 6e93 196-306 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
3-44PF01352KRAB boxNo overlap with loaded model regions
169-189PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
225-247PF00096Zinc finger, C2H2 typeoverlaps 196-306
253-275PF00096Zinc finger, C2H2 typeoverlaps 196-306
309-331PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
337-359PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
365-387PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
393-415PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
421-443PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
449-471PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
504-526PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
532-554PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
588-610PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
616-641PF13912C2H2-type zinc fingerNo overlap with loaded model regions
649-671PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions