ModCRE DB

Transcription factor

B3KP91

cDNA FLJ31448 fis, clone NT2NE2000950, highly similar to Zinc finger protein 200

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 394 aa

28 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M00217_2.00 NN 70+% CisBP TTACTCAATAT 99.7% identity Open · Scan
Nearest Neighbor (70% - 40%)27
MotifPredictionSourceDNA bindingSupportLogoActions
M00939_2.00 NN 70-40% CisBP CCACCTCA 58.2% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 58.2% identity Open · Scan
M06053_2.00 NN 70-40% CisBP GAAGCCATAACGGC 56.2% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 55.6% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 54.4% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 54.4% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.4% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 54.4% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 54.4% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 54.4% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 54.4% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 54.3% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 53.1% identity Open · Scan
MA1651.1 NN 70-40% JASPAR GTTCCAAAATGGCTGCCTCCG 52.3% identity Open · Scan
M07777_2.00 NN 70-40% CisBP GCCAATTTCCGTGGTGTAAAT 51.1% identity Open · Scan
M08247_2.00 NN 70-40% CisBP AAAAATAACAAACGG 51.0% identity Open · Scan
MA1594.1 NN 70-40% JASPAR AGGGGACATCACTACAGATCCCAC 51.0% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.9% identity Open · Scan
M07753_2.00 NN 70-40% CisBP TGCATTCCTTGGCTTGTG 50.7% identity Open · Scan
M08342_2.00 NN 70-40% CisBP GCTCTGCCTCCCTCT 50.7% identity Open · Scan
M08355_2.00 NN 70-40% CisBP GCGAACTCCTATTCATCC 50.7% identity Open · Scan
M08917_2.00 NN 70-40% CisBP GCTGAGCCATGTGGGGTGCT 50.7% identity Open · Scan
M08267_2.00 NN 70-40% CisBP CAGTTTCATTTTCC 50.0% identity Open · Scan
M08311_2.00 NN 70-40% CisBP CTGGAACAGAAGGGGCGA 50.0% identity Open · Scan
M08860_2.00 NN 70-40% CisBP TCTTATAAGGGCACTAATCCCATT 50.0% identity Open · Scan
MA0095.1 NN 70-40% JASPAR GCCATC 50.0% identity Open · Scan
MA1155.1 NN 70-40% JASPAR TGCACACACTGAAAA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 394 aa
243-385

Region 243-385 0 PWM

Residues
143 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
2I13
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 243-3851 model
Actions
Predicted = Low TFS_B3KP91:243:385_2i13_A_1 2i13 243-385 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
251-273PF00096Zinc finger, C2H2 typeoverlaps 243-385
279-301PF00096Zinc finger, C2H2 typeoverlaps 243-385
307-329PF00096Zinc finger, C2H2 typeoverlaps 243-385
335-357PF00096Zinc finger, C2H2 typeoverlaps 243-385