ModCRE DB

Transcription factor

B3KPC9

cDNA FLJ31622 fis, clone NT2RI2003220, highly similar to Zinc finger protein 337

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 622 aa

25 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07583_2.00 NN 70+% CisBP GAATTTATCACCACT 99.8% identity Open · Scan
Nearest Neighbor (70% - 40%)24
MotifPredictionSourceDNA bindingSupportLogoActions
M00952_2.00 NN 70-40% CisBP GGATGCTC 63.5% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 61.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 60.0% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 60.0% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 58.8% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 58.8% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 58.8% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 57.6% identity Open · Scan
M07610_2.00 NN 70-40% CisBP CCTTCTTCCTCCCCCCTGCCCACC 56.6% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 56.4% identity Open · Scan
M07662_2.00 NN 70-40% CisBP CCTGTGTCCTCCCTGGTCCCC 55.2% identity Open · Scan
M10303_2.00 NN 70-40% CisBP TACTGGGAATACC 52.9% identity Open · Scan
M07645_2.00 NN 70-40% CisBP CTCCTT 52.5% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 51.7% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 51.0% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 51.0% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 50.8% identity Open · Scan
M07623_2.00 NN 70-40% CisBP GTCTAATAGAGCTGGGCTGCA 50.7% identity Open · Scan
M08329_2.00 NN 70-40% CisBP GCTGCATAGTATTCC 50.6% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 50.5% identity Open · Scan
M07578_2.00 NN 70-40% CisBP CAACTCTCC 50.4% identity Open · Scan
M03583_2.00 NN 70-40% CisBP GGATGCTGTG 50.0% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.0% identity Open · Scan
M06112_2.00 NN 70-40% CisBP CTACTTTCACCGGGG 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 622 aa
116-269

Region 116-269 0 PWM

Residues
154 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
2I13
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 116-2691 model
Actions
Predicted = Low TFS_B3KPC9:116:269_2i13_A_1 2i13 116-269 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
79-101PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
107-129PF00096Zinc finger, C2H2 typeoverlaps 116-269
135-157PF00096Zinc finger, C2H2 typeoverlaps 116-269
163-185PF00096Zinc finger, C2H2 typeoverlaps 116-269
191-213PF00096Zinc finger, C2H2 typeoverlaps 116-269
219-241PF00096Zinc finger, C2H2 typeoverlaps 116-269
247-269PF00096Zinc finger, C2H2 typeoverlaps 116-269
275-297PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
303-325PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
331-353PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
361-381PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
387-409PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
415-437PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
499-521PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
556-578PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
584-606PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions