ModCRE DB

Transcription factor

B3KQ07 - ZNF575

Zinc finger protein 575

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 344 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_B3KQ07_B3KQ07_HUMAN:216:269_1llm_C_1 ModCRE Homology model GGCGCCGGCGCT Region 216-269 · 1 3D model Open · Scan
TFS_tr_B3KQ07_B3KQ07_HUMAN:151:334_5v3j_E_1 ModCRE Homology model AGCCCGGGGGGGGAGGGGGGCCC Region 151-334 · 1 3D model Open · Scan
TFS_tr_B3KQ07_B3KQ07_HUMAN:151:334_5v3m_C_1 ModCRE Homology model GGCCTCGGGGGGGTGGGGGGGCCC Region 151-334 · 1 3D model Open · Scan
TFS_tr_B3KQ07_B3KQ07_HUMAN:151:334_5wjq_D_1 ModCRE Homology model TCCTTCGGGGGCGCGGGGGGGGGC Region 151-334 · 1 3D model Open · Scan
TFS_tr_B3KQ07_B3KQ07_HUMAN:160:298_2i13_A_1 ModCRE Homology model ATACTGTATACCCTCCCCAAA Region 160-298 · 1 3D model Open · Scan
TFS_tr_B3KQ07_B3KQ07_HUMAN:161:334_5yef_A_1 ModCRE Homology model AGATGCGCGCGCCCAAGCGAAAAAT Region 161-334 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 344 aa
151-334

Region 151-334 6 PWM

Residues
184 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 5YEF
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 151-3346 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_B3KQ07_B3KQ07_HUMAN:216:269_1llm_C_1 1llm 216-269 View model · PDB
Predicted = Low TFS_tr_B3KQ07_B3KQ07_HUMAN:151:334_5v3j_E_1 5v3j 151-334 View model · PDB
Predicted = Low TFS_tr_B3KQ07_B3KQ07_HUMAN:151:334_5v3m_C_1 5v3m 151-334 View model · PDB
Predicted = Low TFS_tr_B3KQ07_B3KQ07_HUMAN:151:334_5wjq_D_1 5wjq 151-334 View model · PDB
Predicted = Low TFS_tr_B3KQ07_B3KQ07_HUMAN:160:298_2i13_A_1 2i13 160-298 View model · PDB
Predicted = Low TFS_tr_B3KQ07_B3KQ07_HUMAN:161:334_5yef_A_1 5yef 161-334 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
4 2i13 151:334 160 298 P:A · DNA:C,D 43.2% / 59.0% 90 View · PDB TFS_tr_B3KQ07_B3KQ07_HUMAN:160:298_2i13_A_1
1 5wjq 151:334 151 334 P:D · DNA:A,B 38.6% / 54.9% 62 View · PDB TFS_tr_B3KQ07_B3KQ07_HUMAN:151:334_5wjq_D_1
2 5v3m 151:334 151 334 P:C · DNA:A,B 38.6% / 54.9% 62 View · PDB TFS_tr_B3KQ07_B3KQ07_HUMAN:151:334_5v3m_C_1
3 5v3j 151:334 151 334 P:E · DNA:A,B 38.6% / 54.9% 62 View · PDB TFS_tr_B3KQ07_B3KQ07_HUMAN:151:334_5v3j_E_1
5 5yef 151:334 161 334 P:A · DNA:C,D 32.0% / 41.7% 99 View · PDB TFS_tr_B3KQ07_B3KQ07_HUMAN:161:334_5yef_A_1
1 1llm 151:334 216,216 269,269 P:C,D · DNA:A,B 27.8% / 42.6% 62,63 View · PDB DIMER_tr_B3KQ07_B3KQ07_HUMAN:216:269_1llm_C_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
162-184PF00096Zinc finger, C2H2 typeoverlaps 151-334
190-212PF00096Zinc finger, C2H2 typeoverlaps 151-334
218-237PF00096Zinc finger, C2H2 typeoverlaps 151-334
246-268PF00096Zinc finger, C2H2 typeoverlaps 151-334
276-295PF00096Zinc finger, C2H2 typeoverlaps 151-334