ModCRE DB

Transcription factor

B3KQ42

Zinc finger protein 131

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 589 aa

7 Generated PWM 7 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M01447_2.00 NN 70-40% CisBP TACCCCTGA 51.5% identity Open · Scan
M01538_2.00 NN 70-40% CisBP GCCCCTGA 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml4_A_1 ModCRE Homology model GGGCCCCGACTCCCCGCGG Region 289-405 · 1 3D model Open · Scan
TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml5_A_1 ModCRE Homology model GGGCCCCGACTCCCACGGT Region 289-405 · 1 3D model Open · Scan
TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml6_A_1 ModCRE Homology model GGGCCCGGACTCCCACGGG Region 289-405 · 1 3D model Open · Scan
TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml7_A_1 ModCRE Homology model GGGCCACGACTCCCACCGG Region 289-405 · 1 3D model Open · Scan
TFS_tr_B3KQ42_B3KQ42_HUMAN:296:405_8e3e_A_1 ModCRE Homology model TGATCAACTCAGTCTCACAA Region 296-405 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 589 aa
256-288
289-405

Region 256-288 0 PWM

Residues
33 aa
Domains
PF12874 · Zinc-finger of C2H2 type
3D models
1 active PDB · 1 summary row
Templates
5KRB
Sources
Predicted = Low
Scan this region Show models

Region 289-405 5 PWM

Residues
117 aa
Domains
PF12874 · Zinc-finger of C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 6ML4, 6ML5, 6ML6, 6ML7, 8E3E
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
7 active PDB models 7 summary rows
Region 256-2881 model · 1 summary row
Actions
Predicted = Low DIMER_tr_B3KQ42_B3KQ42_HUMAN:256:288_5krb_G_1 5krb 256-288 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 5krb 245:409 256,256 288,288 P:B,G · DNA:A,E 33.3% / 51.5% 44,40 View · PDB DIMER_tr_B3KQ42_B3KQ42_HUMAN:256:288_5krb_G_1
Region 289-4056 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_B3KQ42_B3KQ42_HUMAN:296:340_1llm_C_1 1llm 296-340 View model · PDB
Predicted = Low TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml4_A_1 6ml4 289-405 View model · PDB
Predicted = Low TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml5_A_1 6ml5 289-405 View model · PDB
Predicted = Low TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml6_A_1 6ml6 289-405 View model · PDB
Predicted = Low TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml7_A_1 6ml7 289-405 View model · PDB
Predicted = Low TFS_tr_B3KQ42_B3KQ42_HUMAN:296:405_8e3e_A_1 8e3e 296-405 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 245:409 296,296 340,340 P:C,D · DNA:A,B 44.4% / 55.6% 51,52 View · PDB DIMER_tr_B3KQ42_B3KQ42_HUMAN:296:340_1llm_C_1
5 8e3e 245:409 296 405 P:A · DNA:X,Y 38.2% / 49.1% 91 View · PDB TFS_tr_B3KQ42_B3KQ42_HUMAN:296:405_8e3e_A_1
1 6ml7 245:409 289 405 P:A · DNA:E,F 35.9% / 50.4% 76 View · PDB TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml7_A_1
2 6ml6 245:409 289 405 P:A · DNA:E,F 35.9% / 50.4% 76 View · PDB TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml6_A_1
3 6ml4 245:409 289 405 P:A · DNA:E,F 35.9% / 50.4% 76 View · PDB TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml4_A_1
4 6ml5 245:409 289 405 P:A · DNA:E,F 35.9% / 50.4% 76 View · PDB TFS_tr_B3KQ42_B3KQ42_HUMAN:289:405_6ml5_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
24-126PF00651BTB/POZ domainNo overlap with loaded model regions
254-274PF12874Zinc-finger of C2H2 typeoverlaps 256-288
358-377PF12874Zinc-finger of C2H2 typeoverlaps 289-405