ModCRE DB

Transcription factor

B3KQX0

cDNA FLJ33228 fis, clone ASTRO2001122, highly similar to Zinc finger protein 64, isoforms 1 and 2

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 523 aa

12 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)6
MotifPredictionSourceDNA bindingSupportLogoActions
M08275_2.00 NN 70-40% CisBP CGCTCCCGGGCCCCC 68.7% identity Open · Scan
M08525_2.00 NN 70-40% CisBP CCCCGCA 64.1% identity Open · Scan
M08543_2.00 NN 70-40% CisBP CCACAGTG 54.5% identity Open · Scan
M01868_2.00 NN 70-40% CisBP TCTTGGCG 51.5% identity Open · Scan
M01022_2.00 NN 70-40% CisBP GGACCACCCAC 50.8% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 50.0% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_B3KQX0_B3KQX0_HUMAN:71:119_1llm_C_1 ModCRE Homology model GCCGGGGCCGGG Region 71-119 · 1 3D model Open · Scan
TFS_tr_B3KQX0_B3KQX0_HUMAN:15:236_8ssu_A_1 ModCRE Homology model GGCCCCGCGGGCGCGAAAA Region 15-236 · 1 3D model Open · Scan
TFS_tr_B3KQX0_B3KQX0_HUMAN:17:181_5t0u_A_1 ModCRE Homology model CTTGGGCGGTCGCCGGTCCGCGC Region 17-181 · 1 3D model Open · Scan
TFS_tr_B3KQX0_B3KQX0_HUMAN:3:181_8sss_A_1 ModCRE Homology model GAGGTCCCGGTGCCCTGCCTAGG Region 3-181 · 1 3D model Open · Scan
TFS_tr_B3KQX0_B3KQX0_HUMAN:3:181_8sst_A_1 ModCRE Homology model AAGGCGCCGGTGCCCTGCCTATG Region 3-181 · 1 3D model Open · Scan
TFS_tr_B3KQX0_B3KQX0_HUMAN:3:238_7w1m_H_1 ModCRE Homology model TGTGGCGGGACTGTTTGGGCGCCGCCCCCGGTGCGGGCCTA Region 3-238 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 523 aa
3-238

Region 3-238 6 PWM

Residues
236 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF12874 · Zinc-finger of C2H2 type PF00096 · Zinc finger, C2H2 type PF13909 · C2H2-type zinc-finger domain
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 5T0U, 7W1M, 8SSS, 8SST, 8SSU
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 3-2386 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_B3KQX0_B3KQX0_HUMAN:71:119_1llm_C_1 1llm 71-119 View model · PDB
Predicted = Low TFS_tr_B3KQX0_B3KQX0_HUMAN:15:236_8ssu_A_1 8ssu 15-236 View model · PDB
Predicted = Low TFS_tr_B3KQX0_B3KQX0_HUMAN:17:181_5t0u_A_1 5t0u 17-181 View model · PDB
Predicted = Low TFS_tr_B3KQX0_B3KQX0_HUMAN:3:181_8sss_A_1 8sss 3-181 View model · PDB
Predicted = Low TFS_tr_B3KQX0_B3KQX0_HUMAN:3:181_8sst_A_1 8sst 3-181 View model · PDB
Predicted = Low TFS_tr_B3KQX0_B3KQX0_HUMAN:3:238_7w1m_H_1 7w1m 3-238 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 5t0u 1:257 17 181 P:A · DNA:B,C 47.6% / 60.7% 97 View · PDB TFS_tr_B3KQX0_B3KQX0_HUMAN:17:181_5t0u_A_1
2 8sss 1:257 3 181 P:A · DNA:B,C 47.3% / 62.6% 90 View · PDB TFS_tr_B3KQX0_B3KQX0_HUMAN:3:181_8sss_A_1
3 8sst 1:257 3 181 P:A · DNA:B,C 47.3% / 62.1% 90 View · PDB TFS_tr_B3KQX0_B3KQX0_HUMAN:3:181_8sst_A_1
1 1llm 1:257 71,71 119,119 P:C,D · DNA:A,B 46.9% / 63.3% 56,57 View · PDB DIMER_tr_B3KQX0_B3KQX0_HUMAN:71:119_1llm_C_1
1 7w1m 1:257 3 238 P:H · DNA:F,G 41.9% / 58.9% 73 View · PDB TFS_tr_B3KQX0_B3KQX0_HUMAN:3:238_7w1m_H_1
4 8ssu 1:257 15 236 P:A · DNA:B,C 35.7% / 57.3% 95 View · PDB TFS_tr_B3KQX0_B3KQX0_HUMAN:15:236_8ssu_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
17-37PF00096Zinc finger, C2H2 typeoverlaps 3-238
45-67PF00096Zinc finger, C2H2 typeoverlaps 3-238
73-95PF00096Zinc finger, C2H2 typeoverlaps 3-238
101-123PF00096Zinc finger, C2H2 typeoverlaps 3-238
129-151PF12874Zinc-finger of C2H2 typeoverlaps 3-238
186-207PF00096Zinc finger, C2H2 typeoverlaps 3-238
213-236PF13909C2H2-type zinc-finger domainoverlaps 3-238
267-290PF13912C2H2-type zinc fingerNo overlap with loaded model regions