ModCRE DB

Transcription factor

B3KRD9

cDNA FLJ34085 fis, clone FCBBF3004842, highly similar to TBX19 PROTEIN

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 316 aa

13 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA0804.1 NN 70+% JASPAR TTTCACACCTAGGTGTGAAA 83.3% identity Open · Scan
M06453_2.00 NN 70+% CisBP AAGTGCGA 77.7% identity Open · Scan
Nearest Neighbor (70% - 40%)11
MotifPredictionSourceDNA bindingSupportLogoActions
M02498_2.00 NN 70-40% CisBP AGGTGTCA 55.1% identity Open · Scan
M01030_2.00 NN 70-40% CisBP TTGACACCTC 54.5% identity Open · Scan
MA0009.1 NN 70-40% JASPAR CTAGGTGTGAA 53.7% identity Open · Scan
MA0009.2 NN 70-40% JASPAR TCACACCTAGGTGTGA 52.8% identity Open · Scan
M09427_2.00 NN 70-40% CisBP TTAGCAGGGAGGTGTGAAAT 52.6% identity Open · Scan
MA1567.1 NN 70-40% JASPAR GAGGTGTGAA 52.6% identity Open · Scan
M00833_2.00 NN 70-40% CisBP AGGTGTGA 51.2% identity Open · Scan
MA0807.1 NN 70-40% JASPAR AGGTGTGA 51.2% identity Open · Scan
M03559_2.00 NN 70-40% CisBP AGGTGTGAAATTTCACACCT 50.6% identity Open · Scan
MA0806.1 NN 70-40% JASPAR AGGTGTGA 50.6% identity Open · Scan
MA0690.1 NN 70-40% JASPAR AAGGTGTGAA 50.3% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 316 aa
1-147

Region 1-147 0 PWM

Residues
147 aa
Domains
PF00907 · T-box
3D models
1 active PDB
Templates
4S0H
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 1-1471 model
Actions
Predicted = Low DIMER_B3KRD9:1:147_4s0h_E_1 4s0h 1-147 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
1-148PF00907T-boxoverlaps 1-147