ModCRE DB

Transcription factor

B3KT94

cDNA FLJ37877 fis, clone BRSTN1000097, highly similar to Zinc finger protein 222

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 397 aa

26 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07654_2.00 NN 70+% CisBP TGCCCCCTGGTGGC 77.7% identity Open · Scan
Nearest Neighbor (70% - 40%)25
MotifPredictionSourceDNA bindingSupportLogoActions
M08399_2.00 NN 70-40% CisBP TACTCTGGGGCCACATGACTC 60.1% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 57.8% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 56.6% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 56.6% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 56.3% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 55.7% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 55.4% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 55.4% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 55.4% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 55.4% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 55.0% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 55.0% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 54.2% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.2% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 54.2% identity Open · Scan
M07679_2.00 NN 70-40% CisBP TGCGATCTC 53.2% identity Open · Scan
M06084_2.00 NN 70-40% CisBP AGACCACCCAC 53.1% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 53.0% identity Open · Scan
M07777_2.00 NN 70-40% CisBP GCCAATTTCCGTGGTGTAAAT 52.8% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 52.1% identity Open · Scan
M01199_2.00 NN 70-40% CisBP GCGCCACC 51.0% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.9% identity Open · Scan
M04505_2.00 NN 70-40% CisBP AGCTTTTCCCACAC 50.7% identity Open · Scan
M07605_2.00 NN 70-40% CisBP TATTTTTTTTTATTTTTTTTTTTTTTTTTT 50.4% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 397 aa
119-228

Region 119-228 0 PWM

Residues
110 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
6E93
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 119-2281 model
Actions
Predicted = Low TFS_B3KT94:119:228_6e93_A_1 6e93 119-228 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
91-113PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
119-141PF00096Zinc finger, C2H2 typeoverlaps 119-228
175-197PF00096Zinc finger, C2H2 typeoverlaps 119-228
203-225PF00096Zinc finger, C2H2 typeoverlaps 119-228
259-281PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
287-309PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
315-337PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions