ModCRE DB

Transcription factor

B3KVD4

cDNA FLJ16429 fis, clone BRACE3008238, highly similar to Zinc finger and BTB domain-containing protein 4

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 821 aa

8 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M08864_2.00 NN 70-40% CisBP CCTCCCCCCCCGCCCCCTCCCC 59.0% identity Open · Scan
MA0527.1 NN 70-40% JASPAR CTCTCGCGAGATCTG 57.2% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_B3KVD4_B3KVD4_HUMAN:143:196_1llm_D_1 ModCRE Homology model CCCCGGCCCGGG Region 143-196 · 1 3D model Open · Scan
TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_4f6m_A_1 ModCRE Homology model ACCCTTCCCGGGAACC Region 105-200 · 1 3D model Open · Scan
TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_5vmv_A_1 ModCRE Homology model TCATTCGGGGGATAGT Region 105-200 · 1 3D model Open · Scan
TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_6df5_A_1 ModCRE Homology model ACCTTCCTGAAAAGT Region 105-200 · 1 3D model Open · Scan
TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_6df8_A_1 ModCRE Homology model AAATTTTGGGGAACC Region 105-200 · 1 3D model Open · Scan
TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_6dfc_A_1 ModCRE Homology model ACCTTTCTGAAAAAG Region 105-200 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 821 aa
105-200

Region 105-200 6 PWM

Residues
96 aa
Domains
No overlapping PFAM annotation recorded
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 4F6M, 5VMV, 6DF5, 6DF8, 6DFC
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 105-2006 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_B3KVD4_B3KVD4_HUMAN:143:196_1llm_D_1 1llm 143-196 View model · PDB
Predicted = Low TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_4f6m_A_1 4f6m 105-200 View model · PDB
Predicted = Low TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_5vmv_A_1 5vmv 105-200 View model · PDB
Predicted = Low TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_6df5_A_1 6df5 105-200 View model · PDB
Predicted = Low TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_6df8_A_1 6df8 105-200 View model · PDB
Predicted = Low TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_6dfc_A_1 6dfc 105-200 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6df5 99:200 105 200 P:A · DNA:D,E 57.3% / 75.0% 82 View · PDB TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_6df5_A_1
2 5vmv 99:200 105 200 P:A · DNA:D,E 57.3% / 75.0% 82 View · PDB TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_5vmv_A_1
3 4f6m 99:200 105 200 P:A · DNA:D,E 57.3% / 75.0% 82 View · PDB TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_4f6m_A_1
4 6dfc 99:200 105 200 P:A · DNA:D,E 57.3% / 75.0% 82 View · PDB TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_6dfc_A_1
5 6df8 99:200 105 200 P:A · DNA:D,E 57.3% / 75.0% 81 View · PDB TFS_tr_B3KVD4_B3KVD4_HUMAN:105:200_6df8_A_1
1 1llm 99:200 143,143 196,196 P:C,D · DNA:A,B 29.6% / 48.1% 62,63 View · PDB DIMER_tr_B3KVD4_B3KVD4_HUMAN:143:196_1llm_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
43-60PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
573-595PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions