ModCRE DB

Transcription factor

B3KVG5

cDNA FLJ16522 fis, clone NT2RP7004481, highly similar to Homo sapiens zinc finger protein, subfamily 1A, 4 (Eos) (ZNFN1A4), mRNA

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 483 aa

6 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
MA1508.1 NN 70-40% JASPAR GAAACAGGAAGT 56.2% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_B3KVG5_B3KVG5_HUMAN:58:165_2i13_A_1 ModCRE Homology model AGTTTAGGCCCTAGGGGGCA Region 58-165 · 1 3D model Open · Scan
TFS_tr_B3KVG5_B3KVG5_HUMAN:58:166_5wjq_D_1 ModCRE Homology model CCATGAATCAGGCGCCCT Region 58-166 · 1 3D model Open · Scan
TFS_tr_B3KVG5_B3KVG5_HUMAN:59:165_5egb_A_1 ModCRE Homology model CCGCCGGGGGCAGCCTTT Region 59-165 · 1 3D model Open · Scan
TFS_tr_B3KVG5_B3KVG5_HUMAN:59:165_5eh2_F_1 ModCRE Homology model CCCCAGTGAGGGGGCGGGA Region 59-165 · 1 3D model Open · Scan
TFS_tr_B3KVG5_B3KVG5_HUMAN:59:165_5ei9_E_1 ModCRE Homology model CGGTCCCCCCACTGGGG Region 59-165 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 483 aa
58-166

Region 58-166 5 PWM

Residues
109 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
8 active PDBs · 8 summary rows
Templates
1HWT, 1LLM, 2HAP, 2I13, 5EGB, 5EH2, 5EI9, 5WJQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 8 summary rows
Region 58-1668 models · 8 summary rows
Actions
Predicted = Low DIMER_tr_B3KVG5_B3KVG5_HUMAN:114:166_1hwt_C_1 1hwt 114-166 View model · PDB
Predicted = Low DIMER_tr_B3KVG5_B3KVG5_HUMAN:122:166_2hap_D_1 2hap 122-166 View model · PDB
Predicted = Low DIMER_tr_B3KVG5_B3KVG5_HUMAN:83:131_1llm_C_1 1llm 83-131 View model · PDB
Predicted = Low TFS_tr_B3KVG5_B3KVG5_HUMAN:58:165_2i13_A_1 2i13 58-165 View model · PDB
Predicted = Low TFS_tr_B3KVG5_B3KVG5_HUMAN:58:166_5wjq_D_1 5wjq 58-166 View model · PDB
Predicted = Low TFS_tr_B3KVG5_B3KVG5_HUMAN:59:165_5egb_A_1 5egb 59-165 View model · PDB
Predicted = Low TFS_tr_B3KVG5_B3KVG5_HUMAN:59:165_5eh2_F_1 5eh2 59-165 View model · PDB
Predicted = Low TFS_tr_B3KVG5_B3KVG5_HUMAN:59:165_5ei9_E_1 5ei9 59-165 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 2i13 56:173 58 165 P:A · DNA:C,D 42.6% / 57.4% 68 View · PDB TFS_tr_B3KVG5_B3KVG5_HUMAN:58:165_2i13_A_1
2 5ei9 56:173 59 165 P:E · DNA:A,B 40.2% / 54.2% 91 View · PDB TFS_tr_B3KVG5_B3KVG5_HUMAN:59:165_5ei9_E_1
3 5egb 56:173 59 165 P:A · DNA:C,D 40.2% / 54.2% 91 View · PDB TFS_tr_B3KVG5_B3KVG5_HUMAN:59:165_5egb_A_1
4 5eh2 56:173 59 165 P:F · DNA:C,D 40.2% / 54.2% 93 View · PDB TFS_tr_B3KVG5_B3KVG5_HUMAN:59:165_5eh2_F_1
5 5wjq 56:173 58 166 P:D · DNA:A,B 39.4% / 57.8% 36 View · PDB TFS_tr_B3KVG5_B3KVG5_HUMAN:58:166_5wjq_D_1
1 1llm 56:173 83,83 131,131 P:C,D · DNA:A,B 36.7% / 51.0% 56,57 View · PDB DIMER_tr_B3KVG5_B3KVG5_HUMAN:83:131_1llm_C_1
3 2hap 56:173 122,122 166,166 P:C,D · DNA:A,B 24.4% / 46.7% 59,60 View · PDB DIMER_tr_B3KVG5_B3KVG5_HUMAN:122:166_2hap_D_1
2 1hwt 56:173 114,114 166,166 P:C,D · DNA:A,B 22.6% / 43.4% 75,71 View · PDB DIMER_tr_B3KVG5_B3KVG5_HUMAN:114:166_1hwt_C_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
113-135PF00096Zinc finger, C2H2 typeoverlaps 58-166
146-169PF00096Zinc finger, C2H2 typeoverlaps 58-166