Transcription factor

B3KVJ1

Zinc finger protein 655

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 298 aa

19 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M00250_2.00	NN 70+%	CisBP	AATGCTAACT	99.6% identity		Open · Scan

Nearest Neighbor (70% - 40%)18

Motif	Prediction	Source	DNA binding	Support	Actions
M01181_2.00	NN 70-40%	CisBP	GCGCATCCCC	57.1% identity	Open · Scan
M00960_2.00	NN 70-40%	CisBP	TGCATCCC	56.6% identity	Open · Scan
MA0029.1	NN 70-40%	JASPAR	AAGATAAGATAACA	55.8% identity	Open · Scan
M04653_2.00	NN 70-40%	CisBP	GGTACGGTTGTCCATGTTGCAA	55.5% identity	Open · Scan
M04611_2.00	NN 70-40%	CisBP	CTTTCGGACAC	55.3% identity	Open · Scan
MA0073.1	NN 70-40%	JASPAR	CCCCAAACCACCCCCCCCCA	55.1% identity	Open · Scan
M00958_2.00	NN 70-40%	CisBP	CGGCATCCC	53.3% identity	Open · Scan
M00944_2.00	NN 70-40%	CisBP	TCGCTATAA	53.0% identity	Open · Scan
M00943_2.00	NN 70-40%	CisBP	CCCGCTGC	51.8% identity	Open · Scan
M00952_2.00	NN 70-40%	CisBP	GGATGCTC	51.8% identity	Open · Scan
M00953_2.00	NN 70-40%	CisBP	ATCTATAT	51.8% identity	Open · Scan
M00645_2.00	NN 70-40%	CisBP	CGCCCACGCA	50.8% identity	Open · Scan
MA0095.1	NN 70-40%	JASPAR	GCCATC	50.8% identity	Open · Scan
MA0748.1	NN 70-40%	JASPAR	GTCCGCCATTA	50.8% identity	Open · Scan
M00939_2.00	NN 70-40%	CisBP	CCACCTCA	50.6% identity	Open · Scan
M00955_2.00	NN 70-40%	CisBP	ACGTCCTCT	50.6% identity	Open · Scan
M00959_2.00	NN 70-40%	CisBP	GCCCTCCC	50.6% identity	Open · Scan
M01442_2.00	NN 70-40%	CisBP	ACCCCACATT	50.0% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 298 aa

15-294

Residues: 280 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 15-2941 model

				Actions
Predicted = Low	TFS_B3KVJ1:15:294_5wjq_D_1	5wjq	15-294	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
19-41	PF00096	Zinc finger, C2H2 type	overlaps 15-294
47-69	PF00096	Zinc finger, C2H2 type	overlaps 15-294
110-132	PF00096	Zinc finger, C2H2 type	overlaps 15-294
187-209	PF00096	Zinc finger, C2H2 type	overlaps 15-294
215-237	PF00096	Zinc finger, C2H2 type	overlaps 15-294