Transcription factor

B3KVN4

cDNA FLJ16812 fis, clone THYMU3025865, highly similar to Zinc finger protein GFI-1

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 422 aa

15 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)6

Motif	Prediction	Source	DNA binding	Support	Actions
MA0038.2	NN 70+%	JASPAR	CAAATCACTGCA	99.7% identity	Open · Scan
M04524_2.00	NN 70+%	CisBP	TAAATCACTGCATTTCACTCA	88.7% identity	Open · Scan
MA0483.1	NN 70+%	JASPAR	AAATCACAGCA	88.7% identity	Open · Scan
MA0038.1	NN 70+%	JASPAR	CAAATCACTG	87.2% identity	Open · Scan
M00619_2.00	NN 70+%	CisBP	TAAATCACGG	76.8% identity	Open · Scan
M08977_2.00	NN 70+%	CisBP	AAATCACAGC	74.2% identity	Open · Scan

Nearest Neighbor (70% - 40%)9

Motif	Prediction	Source	DNA binding	Support	Actions
M04611_2.00	NN 70-40%	CisBP	CTTTCGGACAC	54.7% identity	Open · Scan
M00955_2.00	NN 70-40%	CisBP	ACGTCCTCT	53.5% identity	Open · Scan
M00944_2.00	NN 70-40%	CisBP	TCGCTATAA	51.8% identity	Open · Scan
M00960_2.00	NN 70-40%	CisBP	TGCATCCC	51.8% identity	Open · Scan
M00939_2.00	NN 70-40%	CisBP	CCACCTCA	51.1% identity	Open · Scan
M00943_2.00	NN 70-40%	CisBP	CCCGCTGC	50.6% identity	Open · Scan
M00953_2.00	NN 70-40%	CisBP	ATCTATAT	50.0% identity	Open · Scan
M01456_2.00	NN 70-40%	CisBP	GTGATCGGCG	50.0% identity	Open · Scan
M01529_2.00	NN 70-40%	CisBP	CCCCGCATT	50.0% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 422 aa

251-416

Residues: 166 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5V3J
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 251-4161 model

				Actions
Predicted = Low	TFS_B3KVN4:251:416_5v3j_E_1	5v3j	251-416	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
255-278	PF00096	Zinc finger, C2H2 type	overlaps 251-416
284-306	PF00096	Zinc finger, C2H2 type	overlaps 251-416
312-334	PF00096	Zinc finger, C2H2 type	overlaps 251-416
340-362	PF00096	Zinc finger, C2H2 type	overlaps 251-416
368-390	PF00096	Zinc finger, C2H2 type	overlaps 251-416
398-419	PF00096	Zinc finger, C2H2 type	overlaps 251-416