Region 753-1073 2 PWM
- Residues
- 321 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 5 active PDBs · 5 summary rows
- Templates
- 2I13, 7W1M, 8SSQ, 8SSR, 8SSU
- Sources
- Predicted = Low
Transcription factor
B3KXW2
Zinc finger protein 532
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1301 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE3
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| DIMER_tr_B3KXW2_B3KXW2_HUMAN:1265:1286_1llm_C_1 | ModCRE | Homology model | CCACGCCGGAAA | Region 1265-1286 · 1 3D model | Open · Scan | |
| TFS_tr_B3KXW2_B3KXW2_HUMAN:755:891_2i13_A_1 | ModCRE | Homology model | TTCTAGAGTCCTTACGTCCTT | Region 755-891 · 1 3D model | Open · Scan | |
| TFS_tr_B3KXW2_B3KXW2_HUMAN:755:960_8ssu_A_1 | ModCRE | Homology model | CACGAACGGATCACGTATA | Region 755-960 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
1301 aa
753-1073
1265-1286
Region 1265-1286 1 PWM
- Residues
- 22 aa
- Domains
- PF13912 · C2H2-type zinc finger
- 3D models
- 1 active PDB · 1 summary row
- Templates
- 1LLM
- Sources
- Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
6 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 753-10735 models · 5 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_tr_B3KXW2_B3KXW2_HUMAN:753:1073_7w1m_H_1 | 7w1m | 753-1073 | View model · PDB |
| Predicted = Low | TFS_tr_B3KXW2_B3KXW2_HUMAN:755:891_2i13_A_1 | 2i13 | 755-891 | View model · PDB |
| Predicted = Low | TFS_tr_B3KXW2_B3KXW2_HUMAN:755:960_8ssq_A_1 | 8ssq | 755-960 | View model · PDB |
| Predicted = Low | TFS_tr_B3KXW2_B3KXW2_HUMAN:755:960_8ssr_A_1 | 8ssr | 755-960 | View model · PDB |
| Predicted = Low | TFS_tr_B3KXW2_B3KXW2_HUMAN:755:960_8ssu_A_1 | 8ssu | 755-960 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 1 | 2i13 | 752:963 | 755 | 891 | P:A · DNA:C,D | 28.5% / 42.3% | 88 | View · PDB TFS_tr_B3KXW2_B3KXW2_HUMAN:755:891_2i13_A_1 |
| 3 | 8ssr | 752:963 | 755 | 960 | P:A · DNA:B,C | 24.0% / 38.0% | 75 | View · PDB TFS_tr_B3KXW2_B3KXW2_HUMAN:755:960_8ssr_A_1 |
| 4 | 8ssq | 752:963 | 755 | 960 | P:A · DNA:B,C | 24.0% / 38.0% | 75 | View · PDB TFS_tr_B3KXW2_B3KXW2_HUMAN:755:960_8ssq_A_1 |
| 5 | 8ssu | 752:963 | 755 | 960 | P:A · DNA:B,C | 24.0% / 38.0% | 83 | View · PDB TFS_tr_B3KXW2_B3KXW2_HUMAN:755:960_8ssu_A_1 |
| 2 | 7w1m | 752:963 | 753 | 1073 | P:H · DNA:F,G | 21.1% / 36.8% | 95 | View · PDB TFS_tr_B3KXW2_B3KXW2_HUMAN:753:1073_7w1m_H_1 |
Region 1265-12861 model · 1 summary row
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_tr_B3KXW2_B3KXW2_HUMAN:1265:1286_1llm_C_1 | 1llm | 1265-1286 | View model · PDB |
Model-summary evidence imported for this region.
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 638-682 | PF25412 | ZNF592-like C2H2 zinc finger | No overlap with loaded model regions |
| 1199-1227 | PF16622 | zinc-finger C2H2-type | No overlap with loaded model regions |
| 1265-1286 | PF13912 | C2H2-type zinc finger | overlaps 1265-1286 |