Region 207-383 0 PWM
- Residues
- 177 aa
- Domains
- PF00104 · Ligand-binding domain of nuclear hormone receptor
- 3D models
- 1 active PDB
- Templates
- 5UAN
- Sources
- Structure model
Transcription factor
cDNA FLJ52620, highly similar to Orphan nuclear receptor NR1D2
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 385 aa
Only entries with a generated matrix are shown here.
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M05660_2.00 | Known | CisBP | GATGTGGGTCAGTGGGTCAG | Direct PWM | Open · Scan |
No generated PWM in this category.
No generated PWM in this category.
No generated PWM in this category.
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_B4DDP1:207:383_5uan_B_1 | 5uan | 207-383 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 209-383 | PF00104 | Ligand-binding domain of nuclear hormone receptor | overlaps 207-383 |