ModCRE DB

Transcription factor

B4DJ39

TOX high mobility group box family member 4

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 549 aa

4 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_D_1 ModCRE Homology model CGTCTCGCGCCGGCGGCGA Region 149-221 · 1 3D model Open · Scan
TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_G_1 ModCRE Homology model AATTAACTCGTTCGCGGGCACT Region 149-221 · 1 3D model Open · Scan
TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_J_1 ModCRE Homology model CCGCGAACGGCCGGATACCG Region 149-221 · 1 3D model Open · Scan
TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_M_1 ModCRE Homology model ACAAC Region 149-221 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 549 aa
135-221

Region 135-221 4 PWM

Residues
87 aa
Domains
PF00505 · HMG (high mobility group) box
3D models
8 active PDBs · 5 summary rows
Templates
1J5N, 2GZK, 3NM9, 6CIJ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 5 summary rows
Region 135-2218 models · 5 summary rows
Actions
Predicted = Low TFS_tr_B4DJ39_B4DJ39_HUMAN:135:211_1j5n_A_1 1j5n 135-211 View model · PDB
Predicted = Low TFS_tr_B4DJ39_B4DJ39_HUMAN:135:219_2gzk_A_1 2gzk 135-219 View model · PDB
Predicted = Low TFS_tr_B4DJ39_B4DJ39_HUMAN:142:213_6cij_N_1 6cij 142-213 View model · PDB
Predicted = Low TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_D_1 3nm9 149-221 View model · PDB
Predicted = Low TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_G_1 3nm9 149-221 View model · PDB
Predicted = Low TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_J_1 3nm9 149-221 View model · PDB
Predicted = Low TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_M_1 3nm9 149-221 View model · PDB
Predicted = Low TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_P_1 3nm9 149-221 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 1j5n 135:221 135 211 P:A · DNA:B,C 40.3% / 62.3% 82 View · PDB TFS_tr_B4DJ39_B4DJ39_HUMAN:135:211_1j5n_A_1
1 2gzk 135:221 135 219 P:A · DNA:B,C 40.0% / 64.7% 53 View · PDB TFS_tr_B4DJ39_B4DJ39_HUMAN:135:219_2gzk_A_1
3 6cij 135:221 142 213 P:N · DNA:G,M 38.9% / 63.9% 52 View · PDB TFS_tr_B4DJ39_B4DJ39_HUMAN:142:213_6cij_N_1
4 3nm9 135:221 149 221 P:P · DNA:E,F,H,I,K,L 30.1% / 58.9% 97 View · PDB TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_P_1
5 3nm9 135:221 149 221 P:M · DNA:E,F,H,I,K,L 30.1% / 58.9% 97 View · PDB TFS_tr_B4DJ39_B4DJ39_HUMAN:149:221_3nm9_M_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
151-219PF00505HMG (high mobility group) boxoverlaps 135-221