Transcription factor

B4DMH2

Cellular tumor antigen p53

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 368 aa

5 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3

Motif	Prediction	Source	DNA binding	Support	Actions
M11197_2.00	NN 70+%	CisBP	AGACATGCCCGGGCATGTCC	99.1% identity	Open · Scan
MA0106.1	NN 70+%	JASPAR	CCGGACATGCCCGGGCATGT	93.1% identity	Open · Scan
M03440_2.00	NN 70+%	CisBP	ACATGTCATAGACATGT	75.6% identity	Open · Scan

Nearest Neighbor (70% - 40%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
MA0861.1	NN 70-40%	JASPAR	GACATGTCTGGACATGTC	52.0% identity		Open · Scan
M03438_2.00	NN 70-40%	CisBP	GACATGTCTGGACATGTC	50.9% identity		Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 368 aa

69-330

Residues: 262 aa
Domains: PF00870 · P53 DNA-binding domain PF07710 · P53 tetramerisation motif
3D models: 1 active PDB
Templates: 3Q05
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 69-3301 model

				Actions
Predicted = Low	TFS_B4DMH2:69:330_3q05_A_1	3q05	69-330	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
6-30	PF08563	P53 transactivation motif	No overlap with loaded model regions
35-58	PF18521	Transactivation domain 2	No overlap with loaded model regions
75-263	PF00870	P53 DNA-binding domain	overlaps 69-330
294-332	PF07710	P53 tetramerisation motif	overlaps 69-330