Region 404-419 0 PWM
- Residues
- 16 aa
- Domains
- PF00859 · CTF/NF-I family transcription modulation region
- 3D models
- 1 active PDB
- Templates
- 1GJI
- Sources
- Structure model
Transcription factor
B4DS74
Nuclear factor 1
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 445 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)3
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| MA1643.1 | NN 70+% | JASPAR | TGCCTGGCATTGTGCCAAGCA | 99.5% identity | Open · Scan | |
| M03479_2.00 | NN 70+% | CisBP | CTGGCACTGTGCCAA | 99.4% identity | Open · Scan | |
| M03481_2.00 | NN 70+% | CisBP | GGTGCCAAGT | 79.5% identity | Open · Scan |
Nearest Neighbor (70% - 40%)5
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| MA0670.1 | NN 70-40% | JASPAR | GGTGCCAAGT | 65.2% identity | Open · Scan | |
| M05745_2.00 | NN 70-40% | CisBP | GTTGGCACGGTGCCAAC | 64.4% identity | Open · Scan | |
| MA0119.1 | NN 70-40% | JASPAR | TGGCACCATGCCAA | 64.2% identity | Open · Scan | |
| MA0671.1 | NN 70-40% | JASPAR | CGTGCCAAG | 63.2% identity | Open · Scan | |
| M05741_2.00 | NN 70-40% | CisBP | GTTGGCACGGTGCCAGG | 59.3% identity | Open · Scan |
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
445 aa
404-419
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 404-4191 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_B4DS74:404:419_1gji_A_1 | 1gji | 404-419 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 9-47 | PF10524 | Nuclear factor I protein pre-N-terminus | No overlap with loaded model regions |
| 70-171 | PF03165 | MH1 domain | No overlap with loaded model regions |
| 209-416 | PF00859 | CTF/NF-I family transcription modulation region | overlaps 404-419 |