ModCRE DB

Transcription factor

B4DSY3

cDNA FLJ54309, highly similar to Krueppel-related zinc finger protein 1

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 641 aa

46 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07662_2.00 NN 70+% CisBP CCTGTGTCCTCCCTGGTCCCC 99.8% identity Open · Scan
Nearest Neighbor (70% - 40%)45
MotifPredictionSourceDNA bindingSupportLogoActions
M00959_2.00 NN 70-40% CisBP GCCCTCCC 63.5% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 62.3% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 62.3% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 62.3% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 62.3% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 61.1% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 60.0% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 60.0% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 58.8% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 58.8% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 57.7% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 57.2% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 56.6% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 56.4% identity Open · Scan
M07610_2.00 NN 70-40% CisBP CCTTCTTCCTCCCCCCTGCCCACC 55.2% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 55.0% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 55.0% identity Open · Scan
M04505_2.00 NN 70-40% CisBP AGCTTTTCCCACAC 54.7% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 54.3% identity Open · Scan
M08267_2.00 NN 70-40% CisBP CAGTTTCATTTTCC 53.4% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 53.3% identity Open · Scan
M00609_2.00 NN 70-40% CisBP GGAAGCCCTA 53.2% identity Open · Scan
M04613_2.00 NN 70-40% CisBP CTCATGTGCTAATTACAAA 53.1% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 52.8% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 52.6% identity Open · Scan
M04621_2.00 NN 70-40% CisBP AGCAATTCCGCTCA 52.5% identity Open · Scan
M08373_2.00 NN 70-40% CisBP CCCCCTGGCTCTTCCTCT 52.5% identity Open · Scan
M07578_2.00 NN 70-40% CisBP CAACTCTCC 52.2% identity Open · Scan
M08901_2.00 NN 70-40% CisBP CCAGTTCACACC 52.1% identity Open · Scan
M03671_2.00 NN 70-40% CisBP ATTACCATACAAGTGCAC 51.6% identity Open · Scan
M04536_2.00 NN 70-40% CisBP ACGTAACCCGATACC 51.5% identity Open · Scan
M08283_2.00 NN 70-40% CisBP GACTTTTATTTT 51.5% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 51.4% identity Open · Scan
M10303_2.00 NN 70-40% CisBP TACTGGGAATACC 51.4% identity Open · Scan
M08935_2.00 NN 70-40% CisBP CCTCCTCCCTCAGACC 51.3% identity Open · Scan
M08392_2.00 NN 70-40% CisBP CTTCACCTGCTGAGG 51.2% identity Open · Scan
M07605_2.00 NN 70-40% CisBP TATTTTTTTTTATTTTTTTTTTTTTTTTTT 51.0% identity Open · Scan
M08887_2.00 NN 70-40% CisBP CCTCCTCCAGGAAGCCTTCCCTGA 50.9% identity Open · Scan
M08525_2.00 NN 70-40% CisBP CCCCGCA 50.8% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 50.4% identity Open · Scan
M04590_2.00 NN 70-40% CisBP TGCGCTAACCATTGC 50.4% identity Open · Scan
M07645_2.00 NN 70-40% CisBP CTCCTT 50.3% identity Open · Scan
M08314_2.00 NN 70-40% CisBP ATTCATCAAGGTCCTCAACAATGG 50.1% identity Open · Scan
M07583_2.00 NN 70-40% CisBP GAATTTATCACCACT 50.0% identity Open · Scan
M08355_2.00 NN 70-40% CisBP GCGAACTCCTATTCATCC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 641 aa
281-390

Region 281-390 0 PWM

Residues
110 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 281-3901 model
Actions
Predicted = Low TFS_B4DSY3:281:390_5egb_A_1 5egb 281-390 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
14-53PF01352KRAB boxNo overlap with loaded model regions
96-113PF21225C2H2-type zinc fingerNo overlap with loaded model regions
283-305PF00096Zinc finger, C2H2 typeoverlaps 281-390
311-333PF00096Zinc finger, C2H2 typeoverlaps 281-390
339-361PF00096Zinc finger, C2H2 typeoverlaps 281-390
367-389PF00096Zinc finger, C2H2 typeoverlaps 281-390
395-417PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
423-445PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
451-473PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
479-501PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
507-529PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
535-557PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
589-611PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
617-639PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions