Transcription factor

B4DU09

cDNA FLJ55295, highly similar to Nuclear factor of activated T-cells,cytoplasmic 4

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 641 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)4

Motif	Prediction	Source	DNA binding	Support	Actions
MA1525.1	NN 70+%	JASPAR	AATGGAAAAT	99.4% identity	Open · Scan
M05703_2.00	NN 70+%	CisBP	ATTTTCCGTT	97.3% identity	Open · Scan
MA0152.1	NN 70+%	JASPAR	TTTTCCA	74.7% identity	Open · Scan
M03449_2.00	NN 70+%	CisBP	AGGGAAAATAATTTTCCATT	70.0% identity	Open · Scan

Nearest Neighbor (70% - 40%)4

Motif	Prediction	Source	DNA binding	Support	Actions
MA0624.1	NN 70-40%	JASPAR	ATTTTCCATT	69.5% identity	Open · Scan
M02446_2.00	NN 70-40%	CisBP	ATTTTCCATT	68.5% identity	Open · Scan
M05693_2.00	NN 70-40%	CisBP	ATTTTCCATT	52.8% identity	Open · Scan
MA0625.1	NN 70-40%	JASPAR	ATTTTCCATT	52.8% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 641 aa

381-559

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 381-5591 model

				Actions
Predicted = Low	DIMER_B4DU09:381:559_1imh_D_1	1imh	381-559	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
396-554	PF00554	Rel homology DNA-binding domain	overlaps 381-559