ModCRE DB

Transcription factor

B4DV46

cDNA FLJ58262, highly similar to Zinc finger protein 707

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 296 aa

19 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)14
MotifPredictionSourceDNA bindingSupportLogoActions
M00960_2.00 NN 70-40% CisBP TGCATCCC 55.5% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 51.8% identity Open · Scan
M07649_2.00 NN 70-40% CisBP CCCCCCCCCCCCTCAGGAATGCC 51.3% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 51.1% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.0% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 50.0% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 50.0% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 50.0% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 50.0% identity Open · Scan
M05844_2.00 NN 70-40% CisBP TCACCTGT 50.0% identity Open · Scan
M07700_2.00 NN 70-40% CisBP ATGTTGTGAGGAAGCCCA 50.0% identity Open · Scan
M07712_2.00 NN 70-40% CisBP ACATTTTTTTAATCTAAAAAAACATTTACA 50.0% identity Open · Scan
MA0103.1 NN 70-40% JASPAR CACCTG 50.0% identity Open · Scan
MA0103.2 NN 70-40% JASPAR CCTCACCTG 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_B4DV46_B4DV46_HUMAN:101:291_5wjq_D_1 ModCRE Homology model GGTGGTTGAAAGGGGGGGGTGACCCTT Region 101-291 · 1 3D model Open · Scan
TFS_tr_B4DV46_B4DV46_HUMAN:116:263_2i13_A_1 ModCRE Homology model TCAGACCAACAGGCCTAAAAA Region 116-263 · 1 3D model Open · Scan
TFS_tr_B4DV46_B4DV46_HUMAN:154:263_5ei9_E_1 ModCRE Homology model CCCCCCGGGGGGGGCCC Region 154-263 · 1 3D model Open · Scan
TFS_tr_B4DV46_B4DV46_HUMAN:98:291_5v3j_E_1 ModCRE Homology model CCGGGGGCCCCCCCGGGGGCGTC Region 98-291 · 1 3D model Open · Scan
TFS_tr_B4DV46_B4DV46_HUMAN:98:291_5v3m_C_1 ModCRE Homology model CCCTTTGGTGGGCAGGGGGTGGCC Region 98-291 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 296 aa
98-291

Region 98-291 5 PWM

Residues
194 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 98-2916 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_B4DV46_B4DV46_HUMAN:127:178_1llm_D_1 1llm 127-178 View model · PDB
Predicted = Low TFS_tr_B4DV46_B4DV46_HUMAN:101:291_5wjq_D_1 5wjq 101-291 View model · PDB
Predicted = Low TFS_tr_B4DV46_B4DV46_HUMAN:116:263_2i13_A_1 2i13 116-263 View model · PDB
Predicted = Low TFS_tr_B4DV46_B4DV46_HUMAN:154:263_5ei9_E_1 5ei9 154-263 View model · PDB
Predicted = Low TFS_tr_B4DV46_B4DV46_HUMAN:98:291_5v3j_E_1 5v3j 98-291 View model · PDB
Predicted = Low TFS_tr_B4DV46_B4DV46_HUMAN:98:291_5v3m_C_1 5v3m 98-291 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 5ei9 89:291 154 263 P:E · DNA:A,B 50.9% / 66.4% 99 View · PDB TFS_tr_B4DV46_B4DV46_HUMAN:154:263_5ei9_E_1
4 2i13 89:291 116 263 P:A · DNA:C,D 48.0% / 66.9% 96 View · PDB TFS_tr_B4DV46_B4DV46_HUMAN:116:263_2i13_A_1
1 5wjq 89:291 101 291 P:D · DNA:A,B 46.6% / 61.3% 67 View · PDB TFS_tr_B4DV46_B4DV46_HUMAN:101:291_5wjq_D_1
2 5v3m 89:291 98 291 P:C · DNA:A,B 44.8% / 58.2% 70 View · PDB TFS_tr_B4DV46_B4DV46_HUMAN:98:291_5v3m_C_1
3 5v3j 89:291 98 291 P:E · DNA:A,B 44.8% / 58.2% 70 View · PDB TFS_tr_B4DV46_B4DV46_HUMAN:98:291_5v3j_E_1
1 1llm 89:291 127,127 178,178 P:C,D · DNA:A,B 38.5% / 57.7% 59,61 View · PDB DIMER_tr_B4DV46_B4DV46_HUMAN:127:178_1llm_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
129-151PF00096Zinc finger, C2H2 typeoverlaps 98-291
185-207PF00096Zinc finger, C2H2 typeoverlaps 98-291
213-235PF00096Zinc finger, C2H2 typeoverlaps 98-291
241-263PF00096Zinc finger, C2H2 typeoverlaps 98-291
269-291PF00096Zinc finger, C2H2 typeoverlaps 98-291