ModCRE DB

Transcription factor

B4DWF2 - ZNFN1A2

Zinc finger protein, subfamily 1A, 2 (Helios), isoform CRA_d (cDNA FLJ55795, highly similar to Zinc finger protein Helios)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 532 aa

8 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA1508.1 NN 70-40% JASPAR GAAACAGGAAGT 55.4% identity Open · Scan
MA0744.1 NN 70-40% JASPAR ATGCAACAGGTGG 53.3% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_B4DWF2_B4DWF2_HUMAN:172:225_1llm_C_1 ModCRE Homology model TCCGGGCCGCGT Region 172-225 · 1 3D model Open · Scan
TFS_tr_B4DWF2_B4DWF2_HUMAN:119:221_2i13_A_1 ModCRE Homology model AGGGTAAGCCCTCAGCGACA Region 119-221 · 1 3D model Open · Scan
TFS_tr_B4DWF2_B4DWF2_HUMAN:119:222_5wjq_D_1 ModCRE Homology model TCCTCGGGTTATCTGGGG Region 119-222 · 1 3D model Open · Scan
TFS_tr_B4DWF2_B4DWF2_HUMAN:120:221_5egb_A_1 ModCRE Homology model CACACCGGGGGAGCCTTT Region 120-221 · 1 3D model Open · Scan
TFS_tr_B4DWF2_B4DWF2_HUMAN:120:221_5eh2_F_1 ModCRE Homology model CCCCCCGTGGGGGGCGGGA Region 120-221 · 1 3D model Open · Scan
TFS_tr_B4DWF2_B4DWF2_HUMAN:120:221_5ei9_E_1 ModCRE Homology model CACCCTGTGGGGGACGG Region 120-221 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 532 aa
119-225

Region 119-225 6 PWM

Residues
107 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EGB, 5EH2, 5EI9, 5WJQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 119-2256 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_B4DWF2_B4DWF2_HUMAN:172:225_1llm_C_1 1llm 172-225 View model · PDB
Predicted = Low TFS_tr_B4DWF2_B4DWF2_HUMAN:119:221_2i13_A_1 2i13 119-221 View model · PDB
Predicted = Low TFS_tr_B4DWF2_B4DWF2_HUMAN:119:222_5wjq_D_1 5wjq 119-222 View model · PDB
Predicted = Low TFS_tr_B4DWF2_B4DWF2_HUMAN:120:221_5egb_A_1 5egb 120-221 View model · PDB
Predicted = Low TFS_tr_B4DWF2_B4DWF2_HUMAN:120:221_5eh2_F_1 5eh2 120-221 View model · PDB
Predicted = Low TFS_tr_B4DWF2_B4DWF2_HUMAN:120:221_5ei9_E_1 5ei9 120-221 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 2i13 117:229 119 221 P:A · DNA:C,D 44.7% / 62.1% 68 View · PDB TFS_tr_B4DWF2_B4DWF2_HUMAN:119:221_2i13_A_1
5 5wjq 117:229 119 222 P:D · DNA:A,B 41.3% / 61.5% 36 View · PDB TFS_tr_B4DWF2_B4DWF2_HUMAN:119:222_5wjq_D_1
2 5ei9 117:229 120 221 P:E · DNA:A,B 41.2% / 57.8% 91 View · PDB TFS_tr_B4DWF2_B4DWF2_HUMAN:120:221_5ei9_E_1
3 5egb 117:229 120 221 P:A · DNA:C,D 41.2% / 57.8% 91 View · PDB TFS_tr_B4DWF2_B4DWF2_HUMAN:120:221_5egb_A_1
4 5eh2 117:229 120 221 P:F · DNA:C,D 41.2% / 57.8% 93 View · PDB TFS_tr_B4DWF2_B4DWF2_HUMAN:120:221_5eh2_F_1
1 1llm 117:229 172,172 225,225 P:C,D · DNA:A,B 38.9% / 55.6% 62,63 View · PDB DIMER_tr_B4DWF2_B4DWF2_HUMAN:172:225_1llm_C_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
146-168PF00096Zinc finger, C2H2 typeoverlaps 119-225
174-196PF00096Zinc finger, C2H2 typeoverlaps 119-225
202-225PF00096Zinc finger, C2H2 typeoverlaps 119-225