Transcription factor

B4DXY4

cDNA FLJ51730, highly similar to Zinc finger protein 408

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 712 aa

10 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)5

Motif	Prediction	Source	DNA binding	Support	Actions
M06102_2.00	NN 70-40%	CisBP	GCTCAATAA	52.9% identity	Open · Scan
M08908_2.00	NN 70-40%	CisBP	GCTGCTGCTTCTGCTG	51.2% identity	Open · Scan
M00943_2.00	NN 70-40%	CisBP	CCCGCTGC	50.0% identity	Open · Scan
M00959_2.00	NN 70-40%	CisBP	GCCCTCCC	50.0% identity	Open · Scan
M00960_2.00	NN 70-40%	CisBP	TGCATCCC	50.0% identity	Open · Scan

ModCRE5

Motif	Prediction	Source	DNA binding	Support	Actions
TFS_tr_B4DXY4_B4DXY4_HUMAN:345:621_5v3j_E_1	ModCRE	Homology model	CCCCCCCGGTCCCCCGAGTTGCAGGC	Region 345-621 · 1 3D model	Open · Scan
TFS_tr_B4DXY4_B4DXY4_HUMAN:345:621_5v3m_C_1	ModCRE	Homology model	CGGCAGGGGGTACGGCGCGGGGGGCA	Region 345-621 · 1 3D model	Open · Scan
TFS_tr_B4DXY4_B4DXY4_HUMAN:345:621_5wjq_D_1	ModCRE	Homology model	CCCGGGGGCGGTAGAAGATGGGGGGGGG	Region 345-621 · 1 3D model	Open · Scan
TFS_tr_B4DXY4_B4DXY4_HUMAN:425:569_6ml7_A_1	ModCRE	Homology model	CCCCCTAGGCCATGCAAAA	Region 425-569 · 1 3D model	Open · Scan
TFS_tr_B4DXY4_B4DXY4_HUMAN:438:593_2i13_A_1	ModCRE	Homology model	AACGTTAGCCTACTACTTAAA	Region 438-593 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 712 aa

345-621

Residues: 277 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 6 active PDBs · 6 summary rows
Templates: 1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 6ML7
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 345-6216 models · 6 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
4	2i13	343:625	438	593	P:A · DNA:C,D	44.6% / 61.1%	99	View · PDB TFS_tr_B4DXY4_B4DXY4_HUMAN:438:593_2i13_A_1
1	1llm	343:625	486,486	534,534	P:C,D · DNA:A,B	42.9% / 57.1%	56,57	View · PDB DIMER_tr_B4DXY4_B4DXY4_HUMAN:486:534_1llm_D_1
5	6ml7	343:625	425	569	P:A · DNA:E,F	39.7% / 56.2%	99	View · PDB TFS_tr_B4DXY4_B4DXY4_HUMAN:425:569_6ml7_A_1
1	5wjq	343:625	345	621	P:D · DNA:A,B	38.5% / 51.1%	97	View · PDB TFS_tr_B4DXY4_B4DXY4_HUMAN:345:621_5wjq_D_1
2	5v3m	343:625	345	621	P:C · DNA:A,B	37.4% / 51.1%	98	View · PDB TFS_tr_B4DXY4_B4DXY4_HUMAN:345:621_5v3m_C_1
3	5v3j	343:625	345	621	P:E · DNA:A,B	37.4% / 51.1%	98	View · PDB TFS_tr_B4DXY4_B4DXY4_HUMAN:345:621_5v3j_E_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
57-165	PF21549	PR domain zinc finger protein 2, PR domain	No overlap with loaded model regions
373-395	PF00096	Zinc finger, C2H2 type	overlaps 345-621
401-423	PF00096	Zinc finger, C2H2 type	overlaps 345-621
429-451	PF00096	Zinc finger, C2H2 type	overlaps 345-621
461-482	PF00096	Zinc finger, C2H2 type	overlaps 345-621
488-510	PF00096	Zinc finger, C2H2 type	overlaps 345-621
545-565	PF00096	Zinc finger, C2H2 type	overlaps 345-621
571-593	PF00096	Zinc finger, C2H2 type	overlaps 345-621
599-621	PF00096	Zinc finger, C2H2 type	overlaps 345-621