Transcription factor

B4DYU5

cDNA FLJ50396, highly similar to Zinc finger and BTB domain-containing protein 17

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 528 aa

16 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)10

Motif	Prediction	Source	DNA binding	Support	Actions
M08540_2.00	NN 70-40%	CisBP	CCCCT	57.1% identity	Open · Scan
M06179_2.00	NN 70-40%	CisBP	TAAGCCTATAGA	56.0% identity	Open · Scan
M00953_2.00	NN 70-40%	CisBP	ATCTATAT	55.7% identity	Open · Scan
M00960_2.00	NN 70-40%	CisBP	TGCATCCC	55.5% identity	Open · Scan
M00952_2.00	NN 70-40%	CisBP	GGATGCTC	54.3% identity	Open · Scan
M00958_2.00	NN 70-40%	CisBP	CGGCATCCC	54.3% identity	Open · Scan
M00948_2.00	NN 70-40%	CisBP	GCAGCACC	53.0% identity	Open · Scan
M00950_2.00	NN 70-40%	CisBP	GCAGCCCA	53.0% identity	Open · Scan
M06112_2.00	NN 70-40%	CisBP	CTACTTTCACCGGGG	52.3% identity	Open · Scan
M00943_2.00	NN 70-40%	CisBP	CCCGCTGC	50.6% identity	Open · Scan

ModCRE6

Motif	Prediction	Source	DNA binding	Support	Actions
DIMER_tr_B4DYU5_B4DYU5_HUMAN:346:392_1llm_D_1	ModCRE	Homology model	TTTTCCTTAAAA	Region 346-392 · 1 3D model	Open · Scan
TFS_tr_B4DYU5_B4DYU5_HUMAN:231:411_5v3j_E_1	ModCRE	Homology model	AACACGGCGTCCCCCCCCCCGG	Region 231-411 · 1 3D model	Open · Scan
TFS_tr_B4DYU5_B4DYU5_HUMAN:231:411_5v3m_C_1	ModCRE	Homology model	GGTCACAAGAAGCCCCAGGCGC	Region 231-411 · 1 3D model	Open · Scan
TFS_tr_B4DYU5_B4DYU5_HUMAN:231:411_5wjq_D_1	ModCRE	Homology model	GGTCAAGACAAGCCCCCGCCGG	Region 231-411 · 1 3D model	Open · Scan
TFS_tr_B4DYU5_B4DYU5_HUMAN:239:396_2i13_A_1	ModCRE	Homology model	AGGGCTACCCAGAGTGTAATT	Region 239-396 · 1 3D model	Open · Scan
TFS_tr_B4DYU5_B4DYU5_HUMAN:316:412_5ei9_E_1	ModCRE	Homology model	GATCTCCCCCCCCGCG	Region 316-412 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 528 aa

231-412

Residues: 182 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13894 · C2H2-type zinc finger
3D models: 6 active PDBs · 6 summary rows
Templates: 1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 231-4126 models · 6 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
5	5ei9	231:414	316	412	P:E · DNA:A,B	42.3% / 58.8%	87	View · PDB TFS_tr_B4DYU5_B4DYU5_HUMAN:316:412_5ei9_E_1
1	1llm	231:414	346,346	392,392	P:C,D · DNA:A,B	40.4% / 59.6%	54,55	View · PDB DIMER_tr_B4DYU5_B4DYU5_HUMAN:346:392_1llm_D_1
4	2i13	231:414	239	396	P:A · DNA:C,D	39.9% / 54.4%	100	View · PDB TFS_tr_B4DYU5_B4DYU5_HUMAN:239:396_2i13_A_1
1	5wjq	231:414	231	411	P:D · DNA:A,B	39.8% / 53.0%	63	View · PDB TFS_tr_B4DYU5_B4DYU5_HUMAN:231:411_5wjq_D_1
2	5v3m	231:414	231	411	P:C · DNA:A,B	39.8% / 53.0%	63	View · PDB TFS_tr_B4DYU5_B4DYU5_HUMAN:231:411_5v3m_C_1
3	5v3j	231:414	231	411	P:E · DNA:A,B	39.8% / 53.0%	63	View · PDB TFS_tr_B4DYU5_B4DYU5_HUMAN:231:411_5v3j_E_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
1-34	PF00651	BTB/POZ domain	No overlap with loaded model regions
230-252	PF00096	Zinc finger, C2H2 type	overlaps 231-412
346-368	PF00096	Zinc finger, C2H2 type	overlaps 231-412
374-396	PF13894	C2H2-type zinc finger	overlaps 231-412