Transcription factor

B4E095

Cellular tumor antigen p53

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 197 aa

6 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3

Motif	Prediction	Source	DNA binding	Support	Actions
MA0106.1	NN 70+%	JASPAR	CCGGACATGCCCGGGCATGT	98.9% identity	Open · Scan
M11197_2.00	NN 70+%	CisBP	AGACATGCCCGGGCATGTCC	98.4% identity	Open · Scan
M03440_2.00	NN 70+%	CisBP	ACATGTCATAGACATGT	75.1% identity	Open · Scan

Nearest Neighbor (70% - 40%)3

Motif	Prediction	Source	DNA binding	Support	Actions
MA0861.1	NN 70-40%	JASPAR	GACATGTCTGGACATGTC	55.7% identity	Open · Scan
M03438_2.00	NN 70-40%	CisBP	GACATGTCTGGACATGTC	54.9% identity	Open · Scan
MA0525.1	NN 70-40%	JASPAR	AGACATGCCCAGACATGCCC	52.2% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 197 aa

65-104

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 65-1041 model

				Actions
Predicted = Low	DIMER_B4E095:65:104_1hf0_B_1	1hf0	65-104	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
1-20	PF18521	Transactivation domain 2	No overlap with loaded model regions
61-185	PF00870	P53 DNA-binding domain	overlaps 65-104