Region 82-156 0 PWM
- Residues
- 75 aa
- Domains
- PF00105 · Double treble clef zinc finger, C4 type
- 3D models
- 1 active PDB
- Templates
- 1DSZ
- Sources
- Structure model
Transcription factor
B4E1J4
cDNA FLJ61038, highly similar to Homo sapiens retinoic acid receptor, alpha (RARA), transcript variant 2, mRNA
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 234 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M09277_2.00 | Known | CisBP | GGGGGATCAAGAGGTCAAGG | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
234 aa
82-156
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 82-1561 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_B4E1J4:82:156_1dsz_A_1 | 1dsz | 82-156 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 82-150 | PF00105 | Double treble clef zinc finger, C4 type | overlaps 82-156 |