ModCRE DB

Transcription factor

B4E2P6

cDNA FLJ50366, highly similar to Zinc finger protein 398

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 337 aa

26 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)20
MotifPredictionSourceDNA bindingSupportLogoActions
MA1154.1 NN 70-40% JASPAR CTTTCCCACAACACGAC 60.7% identity Open · Scan
M00031_2.00 NN 70-40% CisBP TACCCCGCAC 55.0% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 54.7% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 54.7% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 53.5% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 53.5% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 53.5% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 53.5% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 53.5% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 53.5% identity Open · Scan
M01538_2.00 NN 70-40% CisBP GCCCCTGA 53.4% identity Open · Scan
M08358_2.00 NN 70-40% CisBP CCCTCCCCCTCC 53.0% identity Open · Scan
M01442_2.00 NN 70-40% CisBP ACCCCACATT 52.5% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 52.3% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 52.0% identity Open · Scan
M01441_2.00 NN 70-40% CisBP CCCCTGAATT 50.0% identity Open · Scan
M02903_2.00 NN 70-40% CisBP ATGCCACGCCCCTTTTTG 50.0% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 50.0% identity Open · Scan
M08525_2.00 NN 70-40% CisBP CCCCGCA 50.0% identity Open · Scan
M08540_2.00 NN 70-40% CisBP CCCCT 50.0% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_B4E2P6_B4E2P6_HUMAN:204:255_1llm_C_1 ModCRE Homology model CTGCGCGCGAAA Region 204-255 · 1 3D model Open · Scan
TFS_tr_B4E2P6_B4E2P6_HUMAN:131:282_2i13_A_1 ModCRE Homology model CTTCTAGCCCCCTAGCTGTAA Region 131-282 · 1 3D model Open · Scan
TFS_tr_B4E2P6_B4E2P6_HUMAN:147:257_5ei9_E_1 ModCRE Homology model GGGGCCCCGGCCCGGGGC Region 147-257 · 1 3D model Open · Scan
TFS_tr_B4E2P6_B4E2P6_HUMAN:35:282_5wjq_D_1 ModCRE Homology model CCCCCCGGCCCGGCCCGGGGGGCCCCCA Region 35-282 · 1 3D model Open · Scan
TFS_tr_B4E2P6_B4E2P6_HUMAN:40:287_5v3j_E_1 ModCRE Homology model GTCAAACCAACGGGAGGGGCGCG Region 40-287 · 1 3D model Open · Scan
TFS_tr_B4E2P6_B4E2P6_HUMAN:40:287_5v3m_C_1 ModCRE Homology model CTCCACGTCCAAACCCGGCCCGAGA Region 40-287 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 337 aa
35-287

Region 35-287 6 PWM

Residues
253 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 35-2876 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_B4E2P6_B4E2P6_HUMAN:204:255_1llm_C_1 1llm 204-255 View model · PDB
Predicted = Low TFS_tr_B4E2P6_B4E2P6_HUMAN:131:282_2i13_A_1 2i13 131-282 View model · PDB
Predicted = Low TFS_tr_B4E2P6_B4E2P6_HUMAN:147:257_5ei9_E_1 5ei9 147-257 View model · PDB
Predicted = Low TFS_tr_B4E2P6_B4E2P6_HUMAN:35:282_5wjq_D_1 5wjq 35-282 View model · PDB
Predicted = Low TFS_tr_B4E2P6_B4E2P6_HUMAN:40:287_5v3j_E_1 5v3j 40-287 View model · PDB
Predicted = Low TFS_tr_B4E2P6_B4E2P6_HUMAN:40:287_5v3m_C_1 5v3m 40-287 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 5ei9 35:293 147 257 P:E · DNA:A,B 51.4% / 67.6% 100 View · PDB TFS_tr_B4E2P6_B4E2P6_HUMAN:147:257_5ei9_E_1
4 2i13 35:293 131 282 P:A · DNA:C,D 48.7% / 63.8% 98 View · PDB TFS_tr_B4E2P6_B4E2P6_HUMAN:131:282_2i13_A_1
1 1llm 35:293 204,204 255,255 P:C,D · DNA:A,B 42.3% / 61.5% 59,61 View · PDB DIMER_tr_B4E2P6_B4E2P6_HUMAN:204:255_1llm_C_1
2 5v3m 35:293 40 287 P:C · DNA:A,B 39.8% / 51.8% 88 View · PDB TFS_tr_B4E2P6_B4E2P6_HUMAN:40:287_5v3m_C_1
3 5v3j 35:293 40 287 P:E · DNA:A,B 39.8% / 51.8% 88 View · PDB TFS_tr_B4E2P6_B4E2P6_HUMAN:40:287_5v3j_E_1
1 5wjq 35:293 35 282 P:D · DNA:A,B 38.2% / 53.8% 87 View · PDB TFS_tr_B4E2P6_B4E2P6_HUMAN:35:282_5wjq_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
94-115PF00096Zinc finger, C2H2 typeoverlaps 35-287
122-144PF00096Zinc finger, C2H2 typeoverlaps 35-287
150-172PF00096Zinc finger, C2H2 typeoverlaps 35-287
178-200PF00096Zinc finger, C2H2 typeoverlaps 35-287
206-228PF00096Zinc finger, C2H2 typeoverlaps 35-287
234-256PF00096Zinc finger, C2H2 typeoverlaps 35-287
262-282PF00096Zinc finger, C2H2 typeoverlaps 35-287